View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_121 (Length: 239)
Name: NF1435_low_121
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_121 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 10 - 133
Target Start/End: Complemental strand, 36128153 - 36128030
Alignment:
| Q |
10 |
tgagatgaagaggaaaagatcaggtgatgatagatttgaagtgtttaagggtttttgtgagagtgttgtaaagaaaatgatggatcaacaagaagaaatg |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36128153 |
tgagaagaagaggaaaagatcaggtgatgatagatttgaagtgtttaagggtttttgtgagagtgttgtaaagaaaatgatggatcaacaagaagaaatg |
36128054 |
T |
|
| Q |
110 |
cacaacaagcttattgaagatatg |
133 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
36128053 |
cacaacaagcttattgaagatatg |
36128030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 129
Target Start/End: Original strand, 47422275 - 47422367
Alignment:
| Q |
37 |
tgatagatttgaagtgtttaagggtttttgtgagagtgttgtaaagaaaatgatggatcaacaagaagaaatgcacaacaagcttattgaaga |
129 |
Q |
| |
|
||||||||||||| |||| ||| |||||||||||| || || || ||||| || | |||||||||||||| ||||| ||||| ||||||| |
|
|
| T |
47422275 |
tgatagatttgaaatgttgaagagtttttgtgagacagtggttaataaaataatagcacaacaagaagaaatacacaataagctacttgaaga |
47422367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University