View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1435_low_127 (Length: 238)

Name: NF1435_low_127
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1435_low_127
NF1435_low_127
[»] chr2 (1 HSPs)
chr2 (152-184)||(5106437-5106469)


Alignment Details
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 184
Target Start/End: Original strand, 5106437 - 5106469
Alignment:
152 ttctttgtgtgtcctaaagctacaagatgttgg 184  Q
    |||||||||||||||||||||||||||||||||    
5106437 ttctttgtgtgtcctaaagctacaagatgttgg 5106469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University