View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_132 (Length: 236)
Name: NF1435_low_132
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_132 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 63 - 220
Target Start/End: Original strand, 41733189 - 41733347
Alignment:
| Q |
63 |
gatgatagacttgatttttattggaattttatagattaaatttgatcatttacatttgttaatatgcataatttgatcaatttctactaataatatttca |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41733189 |
gatgatagacttgatttttattggaattttatagattaaatttgatcatttacatttgttaatatgcataatttgatcaatttctactaataatatttca |
41733288 |
T |
|
| Q |
163 |
tcaactatggagtaattaat-aaactattacttaccaactcgccttttctgcatctttg |
220 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41733289 |
tcaactatggagtaattaataaaactattacttaccagctcgccttttctgcatctttg |
41733347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University