View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_133 (Length: 236)
Name: NF1435_low_133
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_133 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 13 - 223
Target Start/End: Complemental strand, 26858041 - 26857831
Alignment:
| Q |
13 |
aatatttggtgctatagtaattctgtttttgcttcaatttatcttttggtttgaaaattaggaaagtattaattatgttttttcaatttgattcacgttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26858041 |
aatatttggtgctatagtaattctgtttttgcttcaatttatcttttggtttgaaaattaggaaagtattaattatgttttttcaatttgattcacgttg |
26857942 |
T |
|
| Q |
113 |
tttgatatctcaatcaaatagaattatagaaaccattaatggaatgatatgctttgagtattttaataaaggataggttagtcagatgtatctttgctag |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26857941 |
tttgatatctcaatcaaatagaattatagaaaccattaatggaatgatatgctttgagtattttaataaaggataggttagtcagatgtatctttgctag |
26857842 |
T |
|
| Q |
213 |
actcctacttg |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
26857841 |
actcctacttg |
26857831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 39 - 155
Target Start/End: Complemental strand, 40322545 - 40322425
Alignment:
| Q |
39 |
ttttgcttcaatttatcttttggtttgaaaatt-aggaaagtattaattatgttttttcaatttgattcac--gtt-gtttgatatctcaatcaaataga |
134 |
Q |
| |
|
||||| ||||||||||||||| | ||||||| | || ||||||||||| ||| |||||||||||||| | | ||| ||||| |||||||||||||| | |
|
|
| T |
40322545 |
ttttgtttcaatttatcttttcgcttgaaaaatcagaaaagtattaatcatggtttttcaatttgatcccctagttcgtttgttatctcaatcaaatgaa |
40322446 |
T |
|
| Q |
135 |
attatagaaaccattaatgga |
155 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
40322445 |
attatagaaaccattaatgga |
40322425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University