View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_143 (Length: 227)
Name: NF1435_low_143
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_143 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 65; Significance: 1e-28; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 113 - 177
Target Start/End: Original strand, 7031215 - 7031279
Alignment:
| Q |
113 |
tgcagtaaattgagaagcatgtataagcaataaccctagtccaactgcatcgccgttccagtctg |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7031215 |
tgcagtaaattgagaagcatgtataagcaataaccctagtccaactgcatcgccgttccagtctg |
7031279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 1 - 66
Target Start/End: Original strand, 7031119 - 7031182
Alignment:
| Q |
1 |
atattgctattgttttgtaaggatttcaatattaatcttgtgtgaagcttcttaaaagaagagaag |
66 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7031119 |
atattgctattgtttagtaaggatttcaatattaatct--tgtgaagcttcttaaaagaagagaag |
7031182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 173 - 211
Target Start/End: Original strand, 7031312 - 7031350
Alignment:
| Q |
173 |
gtctgttatagtaaaattgcctaatatcctaattagaat |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7031312 |
gtctgttatagtaaaattgcctaatatcctaattagaat |
7031350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University