View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_149 (Length: 217)
Name: NF1435_low_149
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_149 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 42460922 - 42461126
Alignment:
| Q |
1 |
tttgtgtgtaatttggatattattgctgcgcatctgtagagactaattgttacttgttttatttttctttcagggaatgttggagattttgacggagatg |
100 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42460922 |
tttgcgtgtaatttggatattatcgctgcgcatctgcagagactaattattacttgttttatttttctttcagggaatgttggagattttgacggagatg |
42461021 |
T |
 |
| Q |
101 |
ctgttatcgataccaatgtcctcccatattgtagcatagatcnnnnnnnggagaagaaatccgttggtgaactcgagcaagaatttcttcaagcactcca |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42461022 |
ctgttattgataccaatgtcctcccatattgtagcatagatcaaaaaaaggagaagaaatccgttggtgaactcgagcaagaatttcttcaagcactcca |
42461121 |
T |
 |
| Q |
201 |
agtat |
205 |
Q |
| |
|
||||| |
|
|
| T |
42461122 |
agtat |
42461126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 151 - 205
Target Start/End: Complemental strand, 3188976 - 3188922
Alignment:
| Q |
151 |
gagaagaaatccgttggtgaactcgagcaagaatttcttcaagcactccaagtat |
205 |
Q |
| |
|
||||||||||| |||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
3188976 |
gagaagaaatcacttggtgaacttgagcaagattttcttcaagcacttcaagtat |
3188922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University