View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_153 (Length: 207)
Name: NF1435_low_153
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_153 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 52113630 - 52113813
Alignment:
| Q |
1 |
acgatgctgagcaagaaattcttgagggaaggtgaaacagtagcagcttcagccacatcaggagaaatcattgaagctgtcaatgcagctgcagttaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113630 |
acgatgctgagcaagaaattcttgagggaaggtgaaacagtagcagcttcagccacatcaggagaaatcattgaagctgtcaatgcagctgcagttaaac |
52113729 |
T |
|
| Q |
101 |
ctgtcacaattttctctttcaaggatgctttcactacaaaccttgcgttatggtttgatgctgccacagactttgatggcttcagagtcaatggtg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52113730 |
ctgtcacaattttctctttcaaggatgctttcactacaaaccttgc------------tgctgccacagactttgatggcttcagagtcaatggtg |
52113813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 4 - 86
Target Start/End: Complemental strand, 18100368 - 18100289
Alignment:
| Q |
4 |
atgctgagcaagaaattcttgagggaaggtgaaacagtagcagcttcagccacatcaggagaaatcattgaagctgtcaatgc |
86 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||| || |||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
18100368 |
atgctgagcaagaagttcttgagagaaggtgaaac---ggccgcttcagccacatcaggaaccaccattgaagctgtcaatgc |
18100289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University