View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_50 (Length: 368)
Name: NF1435_low_50
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 24 - 357
Target Start/End: Original strand, 45625865 - 45626198
Alignment:
| Q |
24 |
ttgcaaaagaaacgcaaggcggtgttcccggctcacctgcaaggacaattaggtcatgtcagattcgccccagctgacccaccagactttctaaactatg |
123 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45625865 |
ttgcaaaagaaacgcaaggcgatgttcccggctcacctgcaaggacaattaggtcatgtcagattcgccccagctgacccaccagactttctaaactatg |
45625964 |
T |
|
| Q |
124 |
aaggatgcgagtttttgctcatatctgcttctgaccatattgaagatgagttgggtcttgagcttctgactgaagaaggggaacatgatgcatcctgctc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45625965 |
aaggatgcgagtttttgctcatatctgcttctgaccatattgaagatgagttgggtcttgagcttctgactgaagaaggggagcatgatgcatcctgctc |
45626064 |
T |
|
| Q |
224 |
tgatctcctcgacacttttaaatttgaagacactccaactccctctactgttccccttctcaagggaatttggacctgaaatcaaatcaatataaatata |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45626065 |
tgatctcctcgacacttttaaatttgaagacactgcaactccctctactgttccccttctcaagggaatttggacctgaaatcaaatcaatataaatata |
45626164 |
T |
|
| Q |
324 |
gctttcgaatagtatagtcatgtatgttaatatt |
357 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45626165 |
gctttcgaatagtatagtcatgtatgttaatatt |
45626198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University