View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_60 (Length: 331)
Name: NF1435_low_60
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_60 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 118 - 314
Target Start/End: Complemental strand, 3651738 - 3651542
Alignment:
| Q |
118 |
ttagttaagaaggtttttcatgatgtgcaaattatattatcaaccacttccattttaaggaaatattatcaaccgcttcatccaccaaatttttatttgt |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
3651738 |
ttagttaagaaggtttttcatgaggtgcaagttatattatcaaccacttccattttgaggaaatattatcaaccgtttcatccaccgaatttttatttgt |
3651639 |
T |
|
| Q |
218 |
agaacctttaaccaatgtcttgagggcactgatcagcaagacttttgtaaattttgctgcaaattcttctcaaataaaagtaaattaatactctaac |
314 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3651638 |
agaacctttaaccaataccttgagggcacttatcagcaagactcttataaattttgctgcaaattcttctcaaataaaagtaaattaatactctaac |
3651542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 37 - 121
Target Start/End: Complemental strand, 3652342 - 3652258
Alignment:
| Q |
37 |
aaaagcaccaaaatgacacccttgatggcacacctattttgtgaatgctaccttaaaatacaatgtattaggttatgacatttag |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3652342 |
aaaagcaccaaaatgacacccttgatggcacacctattttgtgaatgctaccttaaaatacaatctattaggttatgacatttag |
3652258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 205 - 246
Target Start/End: Complemental strand, 27506972 - 27506931
Alignment:
| Q |
205 |
aatttttatttgtagaacctttaaccaatgtcttgagggcac |
246 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
27506972 |
aatttttatttgtagattctttaaccattgtcttgagggcac |
27506931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University