View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_74 (Length: 296)
Name: NF1435_low_74
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_74 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 44763311 - 44763594
Alignment:
| Q |
1 |
ctgcatttactctcctcccccatttttccgcaccttgttcttcttcattaatgctatcttacttggtaccatttccataaattcattcatatttacttca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44763311 |
ctgcatttactctcctcccccatttttccgcaccttgttcttcttcattaatgctatcttacttggtaccatttccataaattcattcatatttacttca |
44763410 |
T |
 |
| Q |
101 |
aatgcaagccaccctaatttgcactacataaattcccttcttcatttattaacgttgcttcattaattcatcattctttttaggttattgtcttgttata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
44763411 |
aatgcaagccaccctaatttgcactacataaattcccttcttcatttattaaccttgcttcattaattcaccattctttttaggttattgtcttgttata |
44763510 |
T |
 |
| Q |
201 |
aaggaaactacactttggttggacaaaatgaataggatgcatttcaatgtggtactagtgcttctacttttggtgatatatttt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44763511 |
aaggaaactacactttggttggacaaaatgaataggatgcatttcaatgtggtactagtgcttctacttttggtgatatatttt |
44763594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University