View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_76 (Length: 293)
Name: NF1435_low_76
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_76 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 43224300 - 43224045
Alignment:
| Q |
1 |
accctacatgataaattatttttctttcttttattctattcggtatatttactgcattacgaaaattctataaaaactccctacattaacacagaaaatt |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43224300 |
accctatatgataaattatttttctttcttttattctattcggtatatttactgcattaagaaaattctataaaaactccctacattaacacagaaaatt |
43224201 |
T |
|
| Q |
101 |
tggtgagaattgtactattttcgaaggatagtaactctctatactagcagagtctaagtcttaggtaagttttctaatctctatattgttgcttgcacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43224200 |
tggtgagaattgtactattttcgaaggatagtaactctctatactagcagagtctaagtcttaggtaagttttctaatctctatattgttgcttgcacct |
43224101 |
T |
|
| Q |
201 |
ttcattatgcttcttcttcnnnnnnn---cttgctttgatgtgccttccatttccc |
253 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43224100 |
ttcattatgcttcttcttcttctttttttcttgctttgatgtgccttccatttccc |
43224045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University