View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_82 (Length: 284)
Name: NF1435_low_82
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_82 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 29078043 - 29077782
Alignment:
| Q |
1 |
tgtcttatttgtctgtgatgctaaacataataacaagcaattactaaagacatggcagtgagtgaatacttggatcatgagcaccaatataaatccaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29078043 |
tgtcttatttgtctgtgatgctaaacataataacaagcaattactaaagacatggcagtgagtgaatacttggatcatgagcaccactataaatccaacc |
29077944 |
T |
 |
| Q |
101 |
aagggannnnnnnnggttataagaatcccaagttggattttgtcggtcacacacaaaccctaaatgttactccattgtctataaaggggccccggttaca |
200 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29077943 |
aagggattttttt-ggttataagaatcccaagtttgattttgtcggtcacacacaaaccctaaatgttactccattgtctataaaggggccccggttaca |
29077845 |
T |
 |
| Q |
201 |
taatgtatcttgttctacttacttgttgctttgctttctttctttgtactaagtatgatgttttagg |
267 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29077844 |
taatgtatcttgttct----acttgttgctttgctttctttctttgtactaagtatgatgttttagg |
29077782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University