View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1435_low_96 (Length: 258)
Name: NF1435_low_96
Description: NF1435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1435_low_96 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 23 - 244
Target Start/End: Complemental strand, 55476851 - 55476618
Alignment:
| Q |
23 |
agtggcaaagcgaaggtattgaatttgagtgttccaatgtgtgttgggtacagtcacaacataagctacagaatcgaggagaacagtaacagtgtcagta |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55476851 |
agtggcaaagcgaaggtattgaatttgagtgttccaatgtgtgttgggtacagtcacaacataagctacagaatcgaggagaacagtaacagtgtcagta |
55476752 |
T |
 |
| Q |
123 |
atggtggtggt------------aagctttttaatctgcgcaccttcttcaccaagaaaacctttctaactcactagtgcagtgtctcatctttttattt |
210 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55476751 |
atggtggtggtggtggtggtggtaagctttttaatctgcgcaccttcttcaccaagaaaacctttctaactcactagtgcagtgtctcatatttttattt |
55476652 |
T |
 |
| Q |
211 |
tatattttaactgctgcaatacaatattaatatt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
55476651 |
tatattttaactgctgcaatacaatattaatatt |
55476618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University