View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14360_low_3 (Length: 357)
Name: NF14360_low_3
Description: NF14360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14360_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 109 - 338
Target Start/End: Original strand, 256495 - 256724
Alignment:
| Q |
109 |
gtgcaagttcatctatacactcaactcagacctggtttccttttaaaccacagggacattatggacggcagccgcgcatatcataacggcagtgattggt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
256495 |
gtgcaagttcatctatacactcaactcaatcctggtttccttttaaaccacagggacattatggaccgcagccgcgcatatcataacggcagtgattggt |
256594 |
T |
|
| Q |
209 |
gctggtgtgctgacattgccatgggtgatggctcaaatgggatggatccttggtatatcatatataataatcgtaggtgctgtcacactctacacatcca |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
256595 |
gctggtgtgctgacattgccatgggtgatggctcaaatgggatggatccttggtatatcatatataataatcgtaggtactgtcacactctacacatcca |
256694 |
T |
|
| Q |
309 |
atcttctagcagattgttacagaacaccag |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
256695 |
atcttctagcagattgttacagaacaccag |
256724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 191 - 338
Target Start/End: Complemental strand, 227726 - 227579
Alignment:
| Q |
191 |
ataacggcagtgattggtgctggtgtgctgacattgccatgggtgatggctcaaatgggatggatccttggtatatcatatataataatcgtaggtgctg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
227726 |
ataacggcagtgattggtgctggtgtgctgacattgccatgggtgatggctcaaatgggatggatccttggtatatcatatataataatcgtaggtactg |
227627 |
T |
|
| Q |
291 |
tcacactctacacatccaatcttctagcagattgttacagaacaccag |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
227626 |
tcacactctacacatccaatcttctagcagattgttacagaacaccag |
227579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 34 - 93
Target Start/End: Complemental strand, 228195 - 228136
Alignment:
| Q |
34 |
gacctgatgtggttgtatctacatatataaaatttcctcaatagcaccatgaattcgtta |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
228195 |
gacctgatgtggttgtatctacatatataaaatttcctcaaaagcaccatgatttcgtta |
228136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 256124 - 256182
Alignment:
| Q |
48 |
gtatctacatatataaaatttcctcaatagcaccatgaattcgttaaattcttcttgatt |
107 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
256124 |
gtatctacgtatataaattttc-tcaatagcaccatgaattccttaaattcttcttgatt |
256182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University