View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14360_low_5 (Length: 280)
Name: NF14360_low_5
Description: NF14360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14360_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 7534327 - 7534510
Alignment:
| Q |
1 |
ctctgaaacctcgtatttgatggagtaaacttcgatggatcttgctctattcctaccaattgctctgctgccctgcattaaggaaggagaatgaaaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7534327 |
ctctgaaacctcgtatttgatggagtgaacttcgatggatcttgctctattcctaccaattgctctgctgccctgcattaaggaaggagaatgaaaatga |
7534426 |
T |
|
| Q |
101 |
aatggtgagagtgtgttgtgatgagctttatagcactgacacctctgatacaagacgtatgtatctgagataccgacacatgtg |
184 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7534427 |
gatggtgagagtgtgttgtgatgagctctatagcactgacacctctgatagcagacgtatgtatctgagataccgacacatgtg |
7534510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 79
Target Start/End: Original strand, 46964908 - 46964987
Alignment:
| Q |
3 |
ctgaaacctcgtatttgatggagtaaacttcgatggatcttgctct---attcctaccaattgctctgctgccctgcatt |
79 |
Q |
| |
|
||||||||||||||| || || || || || |||||||||||| || ||||||||||||||||| || |||||||||| |
|
|
| T |
46964908 |
ctgaaacctcgtattcgaaggcgtgaatttggatggatcttgcacttcgattcctaccaattgctccgccgccctgcatt |
46964987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University