View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14360_low_7 (Length: 235)

Name: NF14360_low_7
Description: NF14360
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14360_low_7
NF14360_low_7
[»] chr8 (2 HSPs)
chr8 (36-221)||(34582867-34583050)
chr8 (64-172)||(34584907-34585016)
[»] chr4 (1 HSPs)
chr4 (63-166)||(51201188-51201290)
[»] chr5 (1 HSPs)
chr5 (91-168)||(27016028-27016102)


Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 36 - 221
Target Start/End: Complemental strand, 34583050 - 34582867
Alignment:
36 atactaagatagttgacacggttgatgttcatgctcgtgaattaattttcttacatcttagtatgatgacaaaatttgtacaaaaatattgatctgataa 135  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34583050 atactaagatagttgacacggttgatgttcatgctcgtgaattaattttcttacatcttagtatgatgacaaaatttgtacaaaaatattgatctgataa 34582951  T
136 ctatattgatttagttgagaacacattttcatatccactttttaagtctcgtttccttgaacaatccgcttatctgatgatagtaa 221  Q
    |  |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
34582950 c--tattgatttagttgagaacacattttcatatccactttttaagtcttgtttccttgaacaatccgcttatctgatgatagtaa 34582867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 64 - 172
Target Start/End: Complemental strand, 34585016 - 34584907
Alignment:
64 tcatgctcgtgaattaattttcttacatctt---agtatgatgacaaaatttgtacaaaaatattgatctgataactatattgatttagttgagaacaca 160  Q
    |||||||| |||| |||||||||| ||||||   ||||||||| ||||| ||||  ||||||||||||||||| ||  |||||||| |||||| |||| |    
34585016 tcatgctcatgaagtaattttcttccatcttctgagtatgatgccaaaaattgttgaaaaatattgatctgattac--tattgattaagttgaaaacaaa 34584919  T
161 ttttcatatcca 172  Q
    ||||||||||||    
34584918 ttttcatatcca 34584907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 63 - 166
Target Start/End: Complemental strand, 51201290 - 51201188
Alignment:
63 ttcatgctcgtgaattaattttcttacatcttagtatgatgacaaaatttgtacaaaaatattgatctgataactatattgatttagttgagaacacatt 162  Q
    |||||| || |||| |||||||||||||||||||||||||| ||||| ||| ||||||||||| ||||||| ||||| | |||| | |||| ||||||||    
51201290 ttcatgatcatgaagtaattttcttacatcttagtatgatgccaaaaattgaacaaaaatatttatctgattactat-tggattaatttgaaaacacatt 51201192  T
163 ttca 166  Q
    ||||    
51201191 ttca 51201188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 91 - 168
Target Start/End: Original strand, 27016028 - 27016102
Alignment:
91 tcttagtatgatgacaaaatttgtacaaaaatattgatctgataactatattgatttagttgagaacacattttcata 168  Q
    ||||||||||||| ||||||| |||||||||||||||| | || ||  |||||||| |||||| |||| |||||||||    
27016028 tcttagtatgatgccaaaatt-gtacaaaaatattgatttaattac--tattgattaagttgaaaacagattttcata 27016102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University