View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14361_high_11 (Length: 238)
Name: NF14361_high_11
Description: NF14361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14361_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 30 - 221
Target Start/End: Complemental strand, 46069952 - 46069761
Alignment:
| Q |
30 |
cataggagactggatgactgtagggctattgctgcgagatttatgaatatgtatggccgctgtcagaatttagaagtgtctcaaattgctgctggtggtc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46069952 |
cataggagactggatgactgtagggctattgctgcgagatttatgaatatgtatggctgctgtcagaatttagaagtgtctcaaattgctgctggtggtc |
46069853 |
T |
|
| Q |
130 |
aaattttttggtgcagtccacttgttgaaaactcttggttctggtttttgtgatgctcgattgtgatggggcggtgtgcaacttggggtata |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46069852 |
aaattttttggtgcagtccacttgttgaaaactcttggttctggtttttgtgatgctcgattgtgatgggacggtgtgcaacttggggtata |
46069761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 46071975 - 46071942
Alignment:
| Q |
1 |
taatcgtgatactcaatgaggtggtgttccatag |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46071975 |
taatcgtgatactcaatgaggtggtgttccatag |
46071942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University