View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14361_high_2 (Length: 566)
Name: NF14361_high_2
Description: NF14361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14361_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 322; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 45 - 404
Target Start/End: Complemental strand, 38856548 - 38856192
Alignment:
| Q |
45 |
taagtgagaagtagctatttacctgttccgttactacatttgcaggggaatggaaccttgatgacttggttgggattaactttgtaactgttgttggtgt |
144 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38856548 |
taagtgataagtagttatttacctgttctgttactacatttgcaggggaatggaaccttgatgacttggttgggattaactttgtaactgttgttggtgt |
38856449 |
T |
|
| Q |
145 |
tgcttggaaggttgttagctccaaggaggtctaggaagtgttttacaccgaacaaggtagctatttccttcaaggttgttgcgtttgtgctggtgtagtc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38856448 |
tgcttggaaggttgttagctccaaggaggtctaggaagtgttttacaccgaacaaggtagctatttccttcaaggttgttgagtttgtgctggtgtagtc |
38856349 |
T |
|
| Q |
245 |
ggttaaactacgacacgtggcgttttttgttagacacttgaagtttgcttctggttgagcttctgttactgttattattccaacacttgctactagtact |
344 |
Q |
| |
|
|||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38856348 |
ggttaaactacgacacgtagcgttttctgttagacacttgaagtttgcttctggttgagcttctgttactgt---tattccaacacttgctactagtact |
38856252 |
T |
|
| Q |
345 |
actgcaacggtgattaaccatacagtaaccatcttgttccctccactcatgttctttctt |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38856251 |
actgcaacggtgattaaccatacagtaaccatcttgttccctccactcatgttctttctt |
38856192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 429 - 550
Target Start/End: Complemental strand, 38856146 - 38856027
Alignment:
| Q |
429 |
ataactaagtgggggcgttgggtttattgaattcacattatgaatgagtttgaggtttttt--ggtttggatggaatggaaagcactagcaatgtggaat |
526 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38856146 |
ataactaagtgggggcgttgggtttattgaattcacattatga----gtttgaggttttttttggtttggatggaatggaaagcactagcaatgttgaat |
38856051 |
T |
|
| Q |
527 |
gggctttgaataatagagataaat |
550 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
38856050 |
gggctttgaataatagagataaat |
38856027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University