View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14361_low_12 (Length: 238)

Name: NF14361_low_12
Description: NF14361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14361_low_12
NF14361_low_12
[»] chr3 (2 HSPs)
chr3 (30-221)||(46069761-46069952)
chr3 (1-34)||(46071942-46071975)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 30 - 221
Target Start/End: Complemental strand, 46069952 - 46069761
Alignment:
30 cataggagactggatgactgtagggctattgctgcgagatttatgaatatgtatggccgctgtcagaatttagaagtgtctcaaattgctgctggtggtc 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
46069952 cataggagactggatgactgtagggctattgctgcgagatttatgaatatgtatggctgctgtcagaatttagaagtgtctcaaattgctgctggtggtc 46069853  T
130 aaattttttggtgcagtccacttgttgaaaactcttggttctggtttttgtgatgctcgattgtgatggggcggtgtgcaacttggggtata 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
46069852 aaattttttggtgcagtccacttgttgaaaactcttggttctggtttttgtgatgctcgattgtgatgggacggtgtgcaacttggggtata 46069761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 46071975 - 46071942
Alignment:
1 taatcgtgatactcaatgaggtggtgttccatag 34  Q
    ||||||||||||||||||||||||||||||||||    
46071975 taatcgtgatactcaatgaggtggtgttccatag 46071942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University