View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14361_low_13 (Length: 235)
Name: NF14361_low_13
Description: NF14361
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14361_low_13 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 17 - 235
Target Start/End: Complemental strand, 43569240 - 43569022
Alignment:
| Q |
17 |
aaaagcttctcaccaaaaaccatcttcatagttttcaatgtttcttccatcacaagattcccatctctacccttatcctcagcctcgacacaactccctc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43569240 |
aaaagcttctcaccaaaaaccatcttcatagttttcaaggtttcttccatcacaagattcccatctctacccttatcctcagcctccacacaactccctc |
43569141 |
T |
 |
| Q |
117 |
caacattcaccattatcctcccaccttttctcaaagacttgcgtagtttctcccacgtcgcagtctcttgaagctccggtatcaaactcccattcgaaaa |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
43569140 |
caacattcaccattatcctcccaccttttctcaaagacttgcgtagtttctcccacgtcgcagtctcttgaagctccggtatcaaactccccttcgaaaa |
43569041 |
T |
 |
| Q |
217 |
caaatccacaataatgcct |
235 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
43569040 |
caaatcaacaataatgcct |
43569022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University