View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14362_low_3 (Length: 341)
Name: NF14362_low_3
Description: NF14362
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14362_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 18 - 338
Target Start/End: Complemental strand, 265496 - 265176
Alignment:
| Q |
18 |
catcgtcgtaacgaggaacaattggtggagatgataccggaagttgtggagttgaggactttgcataagagggaagaggaattgtatatgtatgatgctt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
265496 |
catcgtcgtaacgaggaacaattggtggagatgataccggaagttgtggagttgaggactttgcataagagggaagaggaattgtatatgtatgatgctt |
265397 |
T |
 |
| Q |
118 |
tttgttatccttgggagaaagataagcattataaaatggtgtatcagttagagaaaaagtattttcctaatcagtgtttggatcaggcttttttgaaacc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
265396 |
tttgttatccttgggagaaagataagcattataaaatggtgtatcagttggagaaaaagtattttcctaatcagtgtttggatcaggcttttttgaaacc |
265297 |
T |
 |
| Q |
218 |
tggtcaatctaattgttcatatgcaagttatacaagttcaaatgctaattcgaatgcgaatactagggttaggaacatgaaagttggtgtttttgggaag |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
265296 |
tggtcaatctaattgttcatatgcaagttatacaagttcaaatgctaattcgaatgcgaatactagggttaggaacatgaaagttggtgtttttgggaag |
265197 |
T |
 |
| Q |
318 |
aataaagaggttggtgatatt |
338 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
265196 |
aataaagaggttggtgatatt |
265176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University