View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14363_high_26 (Length: 318)
Name: NF14363_high_26
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14363_high_26 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0057 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0311 (1 HSPs) |
 |  |  |
|
| [»] scaffold0180 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 5e-56; HSPs: 26)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 48 - 158
Target Start/End: Original strand, 21089003 - 21089113
Alignment:
| Q |
48 |
gatagataaatttcagaatatttgtaattaatatagtttgacttacgatagattgacaatattaaaaaatatttacattgagagtgtatatgaattaaat |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21089003 |
gatagataaatttcagaatatttgtaattaatatagtttgacttacgatagattgacaatattaaaaaatatttacattgagagtgtatatgaattaaat |
21089102 |
T |
 |
| Q |
148 |
aaatttcaata |
158 |
Q |
| |
|
||||||||||| |
|
|
| T |
21089103 |
aaatttcaata |
21089113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 240 - 303
Target Start/End: Original strand, 21089114 - 21089177
Alignment:
| Q |
240 |
gatttgcgattgtgagcatgttagtaataatttgtatgagtaaattgaacttgctcagagatgt |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21089114 |
gatttgcgattgcgagcatgttagtaataatttgtatgagtaaattgaacttgctcagagatgt |
21089177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 22122978 - 22122923
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
22122978 |
atggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttg |
22122923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 35418000 - 35418052
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||| || ||||||||| ||||||||||| |
|
|
| T |
35418000 |
atggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcggg |
35418052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 353410 - 353355
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
353410 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
353355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 13628851 - 13628796
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
13628851 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
13628796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 13730663 - 13730608
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
13730663 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
13730608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 22609861 - 22609916
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| || ||||||||||||| ||||||| |
|
|
| T |
22609861 |
atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttg |
22609916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 24851362 - 24851307
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||||| |||||| ||||||| |
|
|
| T |
24851362 |
atggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttg |
24851307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 39203610 - 39203665
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || |||||| |||||| ||||||| |
|
|
| T |
39203610 |
atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttg |
39203665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 40272873 - 40272818
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
40272873 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
40272818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 54484787 - 54484842
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
54484787 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
54484842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 218
Target Start/End: Original strand, 30452892 - 30452946
Alignment:
| Q |
164 |
tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
30452892 |
tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
30452946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 33926179 - 33926224
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtg |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||| |||| |
|
|
| T |
33926179 |
atggtgggaccccttcctggaccctgcatatgcgagagctttagtg |
33926224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 46170028 - 46169979
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatc |
212 |
Q |
| |
|
||||| ||||||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
46170028 |
atggtaggaccccttcccggaccctgcatatgtgggagcttcagtgcatc |
46169979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 34771425 - 34771373
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| |||| |
|
|
| T |
34771425 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg |
34771373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 54374406 - 54374366
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
54374406 |
atggtgggaccccttcccggaccctgcatatgcgggagctt |
54374366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 1217184 - 1217239
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||| |||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
1217184 |
atggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
1217239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 10795484 - 10795437
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| || ||||||||||||| |
|
|
| T |
10795484 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgca |
10795437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 12914096 - 12914041
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| || |||||||| |||| ||||||| |
|
|
| T |
12914096 |
atggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttg |
12914041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 15797316 - 15797371
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||| |||||| ||||||| |
|
|
| T |
15797316 |
atggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttg |
15797371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 31592943 - 31592998
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||| |||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
31592943 |
atggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
31592998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 49013534 - 49013479
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| ||||| || |||||| |||||| ||||||| |
|
|
| T |
49013534 |
atggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttg |
49013479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 4835854 - 4835896
Alignment:
| Q |
179 |
ccggaccctgcatatacgagagcttcagtgcatcgggttgtcc |
221 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
4835854 |
ccggaccctgcgtatacgtgagcttcagtgcaccgggttgtcc |
4835896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 14987055 - 14987109
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt |
217 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| || |||||| |||||| |||||| |
|
|
| T |
14987055 |
atggtgggacccattcccggaccttgcatatgcgggagctttagtgcaccgggtt |
14987109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 46421096 - 46421056
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
46421096 |
atggtgggaccccttcccggaccctgcgtatgcgggagctt |
46421056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 15)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 148 - 218
Target Start/End: Original strand, 41409921 - 41409991
Alignment:
| Q |
148 |
aaatttcaataatttatggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
41409921 |
aaatttcaagaagttatggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttg |
41409991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 13245156 - 13245101
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||| |||| ||||||||| |
|
|
| T |
13245156 |
atggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttg |
13245101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 23488557 - 23488612
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||| |||||| ||||||| |
|
|
| T |
23488557 |
atggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttg |
23488612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 9671253 - 9671308
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
9671253 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
9671308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 10543774 - 10543829
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
10543774 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
10543829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 10546237 - 10546292
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
10546237 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
10546292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 14530394 - 14530449
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
14530394 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
14530449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 21779322 - 21779267
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
21779322 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
21779267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 25079778 - 25079723
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | ||||||| |||||| ||||||| |
|
|
| T |
25079778 |
atggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttg |
25079723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 218
Target Start/End: Original strand, 34080176 - 34080230
Alignment:
| Q |
164 |
tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||| || |||||| ||||||| |
|
|
| T |
34080176 |
tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttg |
34080230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 217
Target Start/End: Original strand, 34766330 - 34766383
Alignment:
| Q |
164 |
tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||| |||||| |||||| |
|
|
| T |
34766330 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtt |
34766383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 218
Target Start/End: Complemental strand, 40579811 - 40579755
Alignment:
| Q |
162 |
tatggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
40579811 |
tatggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttg |
40579755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 5841104 - 5841151
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| |||||| |
|
|
| T |
5841104 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgca |
5841151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 8455377 - 8455322
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | |||||| |||||| ||||||| |
|
|
| T |
8455377 |
atggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttg |
8455322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 14444802 - 14444849
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| |
|
|
| T |
14444802 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
14444849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 22)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 28817687 - 28817632
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||||||||||| |
|
|
| T |
28817687 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttg |
28817632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 13160775 - 13160830
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||||||||| ||||||| |
|
|
| T |
13160775 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttg |
13160830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 19729414 - 19729453
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19729414 |
atggtgggaccccttcccggaccctgcatatacgggagct |
19729453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 30454158 - 30454103
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
30454158 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
30454103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 45071338 - 45071393
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| || ||||||||||||| ||||||| |
|
|
| T |
45071338 |
atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttg |
45071393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 7136588 - 7136534
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt |
217 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| |||||| |||||| |
|
|
| T |
7136588 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggtt |
7136534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 12670311 - 12670257
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| |||||| |
|
|
| T |
12670311 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt |
12670257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 221
Target Start/End: Original strand, 16225095 - 16225153
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgtcc |
221 |
Q |
| |
|
||||||||| |||||||||||||| |||||| || |||||| |||||| |||||||||| |
|
|
| T |
16225095 |
atggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttgtcc |
16225153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 221
Target Start/End: Original strand, 27507985 - 27508042
Alignment:
| Q |
164 |
tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgtcc |
221 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| || |||||| |||||| |||||||||| |
|
|
| T |
27507985 |
tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcc |
27508042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 8897825 - 8897785
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
8897825 |
atggtgggaccccttcccggaccctgcatatgcgggagctt |
8897785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 219
Target Start/End: Complemental strand, 20284130 - 20284074
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || ||| || |||||| |||||||| |
|
|
| T |
20284130 |
atggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttgt |
20284074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 219
Target Start/End: Complemental strand, 21070758 - 21070702
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || ||| || |||||| |||||||| |
|
|
| T |
21070758 |
atggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttgt |
21070702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 210
Target Start/End: Original strand, 2626600 - 2626643
Alignment:
| Q |
167 |
tgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||||||||| |
|
|
| T |
2626600 |
tgggaccccttcccagaccctgcatatgcgggagcttcagtgca |
2626643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 6760898 - 6760953
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||| ||||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
6760898 |
atggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttg |
6760953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 12625964 - 12626019
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||| ||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
12625964 |
atggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
12626019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20869999 - 20870054
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||| |||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
20869999 |
atggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttg |
20870054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 26102591 - 26102646
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || ||||| |||||| ||||||| |
|
|
| T |
26102591 |
atggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttg |
26102646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 35261753 - 35261808
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
35261753 |
atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttg |
35261808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 39461055 - 39461000
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||| |||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
39461055 |
atggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
39461000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 44530223 - 44530278
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
44530223 |
atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttg |
44530278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 221
Target Start/End: Original strand, 16013530 - 16013588
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgtcc |
221 |
Q |
| |
|
|||||| ||||||||||| |||||||| ||| || |||||| |||||| |||||||||| |
|
|
| T |
16013530 |
atggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtcc |
16013588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 147
Target Start/End: Complemental strand, 40196624 - 40196576
Alignment:
| Q |
98 |
gattgacaatattaaaaaatatttacattgagagtgtatatgaattaaat |
147 |
Q |
| |
|
|||||||||||| |||||||||||||||| | | |||||||||||||||| |
|
|
| T |
40196624 |
gattgacaatat-aaaaaatatttacattaataatgtatatgaattaaat |
40196576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 22)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 7879712 - 7879767
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || ||||||||||||| ||||||| |
|
|
| T |
7879712 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttg |
7879767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 19426950 - 19426896
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||| ||| |||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
19426950 |
atggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggttg |
19426896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 21172070 - 21172015
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
21172070 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
21172015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 27629708 - 27629763
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||| |||||||||| || |||||||||||| ||||||| |
|
|
| T |
27629708 |
atggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttg |
27629763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 32758333 - 32758388
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
32758333 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
32758388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 42391161 - 42391106
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
42391161 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
42391106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 42798743 - 42798798
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||| || ||||| |||||||||||||| |
|
|
| T |
42798743 |
atggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttg |
42798798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 42805600 - 42805655
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
42805600 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
42805655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 48735183 - 48735128
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
48735183 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
48735128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 202
Target Start/End: Complemental strand, 10693134 - 10693095
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
10693134 |
atggtgggaccccttcccggaccctgcatatgcgggagct |
10693095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 31591170 - 31591115
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||| ||||||| || ||||| |||||| ||||||| |
|
|
| T |
31591170 |
atggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttg |
31591115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 34626269 - 34626214
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| || |||||| ||| |||||||||| |
|
|
| T |
34626269 |
atggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttg |
34626214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 40463950 - 40463997
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| || ||||||||||||| |
|
|
| T |
40463950 |
atggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgca |
40463997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 47716535 - 47716590
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| ||||| ||||||| |
|
|
| T |
47716535 |
atggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttg |
47716590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 2541080 - 2541026
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt |
217 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| || |||||| |||||| |||||| |
|
|
| T |
2541080 |
atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtt |
2541026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 209
Target Start/End: Original strand, 33500589 - 33500635
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgc |
209 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || || ||||||||| |
|
|
| T |
33500589 |
atggtgggaccccttcccggaccctgcgtatgcgggatcttcagtgc |
33500635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 35334877 - 35334823
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt |
217 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | |||||| |||||| |||||| |
|
|
| T |
35334877 |
atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtt |
35334823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 18512514 - 18512474
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
18512514 |
atggtgggaccccttcccggaccctgcgtatgcgggagctt |
18512474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 21566510 - 21566562
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg |
215 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| || |||||| |||||| |||| |
|
|
| T |
21566510 |
atggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccggg |
21566562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 27889377 - 27889337
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
27889377 |
atggtgggaccccttcccggaccctgcgtatgcgggagctt |
27889337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 28078193 - 28078153
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||| | ||||||||| ||||||||| |
|
|
| T |
28078193 |
atggtgggaccccttcccgaatcctgcatatgcgagagctt |
28078153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 147
Target Start/End: Complemental strand, 29117950 - 29117895
Alignment:
| Q |
91 |
tacgatagattgacaatattaaaaaatatttacattgagagtgtatatgaattaaat |
147 |
Q |
| |
|
|||||| |||||||||| | |||||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
29117950 |
tacgattgattgacaatct-aaaaaatatttacactgatagtgtatatgaaataaat |
29117895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 16)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 4619165 - 4619110
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||| |||||| ||||||| |
|
|
| T |
4619165 |
atggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttg |
4619110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 8170045 - 8169990
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||| ||||||||| ||||||| |
|
|
| T |
8170045 |
atggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttg |
8169990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 13801828 - 13801773
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||| |||||| ||||||| |
|
|
| T |
13801828 |
atggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttg |
13801773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 16957388 - 16957443
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
16957388 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
16957443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20135680 - 20135735
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| | ||||||||||||| ||||||| |
|
|
| T |
20135680 |
atggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttg |
20135735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 32703496 - 32703551
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
32703496 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
32703551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 38879657 - 38879712
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
38879657 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
38879712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 165 - 218
Target Start/End: Complemental strand, 16028683 - 16028630
Alignment:
| Q |
165 |
ggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
16028683 |
ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
16028630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 24448964 - 24449019
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | |||||| |||||| ||||||| |
|
|
| T |
24448964 |
atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttg |
24449019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 25622534 - 25622581
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| |
|
|
| T |
25622534 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
25622581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 34154875 - 34154820
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||| |||||| ||||||| |
|
|
| T |
34154875 |
atggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttg |
34154820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 41014392 - 41014447
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||| |||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
41014392 |
atggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttg |
41014447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 218
Target Start/End: Original strand, 7368471 - 7368525
Alignment:
| Q |
164 |
tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| |||||| ||||||| |
|
|
| T |
7368471 |
tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttg |
7368525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 218
Target Start/End: Complemental strand, 30877623 - 30877570
Alignment:
| Q |
165 |
ggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| | ||||| |||||| ||||||| |
|
|
| T |
30877623 |
ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttg |
30877570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 10306535 - 10306495
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
10306535 |
atggtgggaccccttcccggaccctgcgtatgcgggagctt |
10306495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 43574680 - 43574720
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
43574680 |
atggtgggaccccttcccggaccctgcgtatgcgggagctt |
43574720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 32)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 23501863 - 23501918
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| |||||| ||||||| |
|
|
| T |
23501863 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
23501918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 32484307 - 32484362
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| |||||| ||||||| |
|
|
| T |
32484307 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
32484362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 5648332 - 5648379
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
5648332 |
atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgca |
5648379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20225056 - 20225111
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
20225056 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
20225111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20225150 - 20225205
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
20225150 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
20225205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20405163 - 20405218
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| ||||||| |||||| |
|
|
| T |
20405163 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttg |
20405218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 20639719 - 20639664
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
20639719 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
20639664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 25629123 - 25629178
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||| ||||| || |||||| |||||| ||||||| |
|
|
| T |
25629123 |
atggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttg |
25629178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 29207959 - 29207904
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
29207959 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
29207904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 33836548 - 33836493
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
33836548 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttg |
33836493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 38755969 - 38755914
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
38755969 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
38755914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 38786683 - 38786738
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
38786683 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
38786738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 44363191 - 44363136
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
44363191 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
44363136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 47444031 - 47444078
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
47444031 |
atggtgggaccccttcccggaccctgcatatgcaggagcttcagtgca |
47444078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 161 - 218
Target Start/End: Complemental strand, 40554000 - 40553943
Alignment:
| Q |
161 |
ttatggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
40554000 |
ttatggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
40553943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 147
Target Start/End: Complemental strand, 24362340 - 24362304
Alignment:
| Q |
111 |
aaaaaatatttacattgagagtgtatatgaattaaat |
147 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24362340 |
aaaaaatatttacattgacagtgtatatgaattaaat |
24362304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 25463196 - 25463236
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
25463196 |
atggtgggaccccttcccggaccctgcatatgcgggagctt |
25463236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 11394926 - 11394981
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
11394926 |
atggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttg |
11394981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 11404653 - 11404708
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||| ||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
11404653 |
atggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttg |
11404708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 16408662 - 16408607
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||| |||||||||||||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
16408662 |
atggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
16408607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 21647040 - 21647095
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
21647040 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
21647095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 25388250 - 25388305
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | |||||| |||||| ||||||| |
|
|
| T |
25388250 |
atggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttg |
25388305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 30639453 - 30639500
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
|||||| |||||||||||||||||||||||| || |||||| |||||| |
|
|
| T |
30639453 |
atggtgagaccccttcccggaccctgcatatgcgggagctttagtgca |
30639500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 40915902 - 40915949
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| || ||||||||||||| |
|
|
| T |
40915902 |
atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgca |
40915949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 221
Target Start/End: Original strand, 8820582 - 8820640
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgtcc |
221 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||||| || |||||||| | |||||| |
|
|
| T |
8820582 |
atggtgggaccccttcccagaccctgcgtatgcgagagttttagtgcatcagattgtcc |
8820640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 193
Target Start/End: Complemental strand, 9832374 - 9832344
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
9832374 |
atggtgggaccccttcccggaccctgcatat |
9832344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 193
Target Start/End: Complemental strand, 30581526 - 30581496
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30581526 |
atggtgggaccccttcccggaccctgcatat |
30581496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 30690236 - 30690190
Alignment:
| Q |
164 |
tggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||| |||||| |
|
|
| T |
30690236 |
tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
30690190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 14983908 - 14983953
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtg |
208 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||| |
|
|
| T |
14983908 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtg |
14983953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 54175138 - 54175191
Alignment:
| Q |
163 |
atggtgggaccccttccc-ggaccctgcatatacgagagcttcagtgcatcggg |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || |||||| |||||| |||| |
|
|
| T |
54175138 |
atggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccggg |
54175191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 7909342 - 7909286
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatac-gagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||| ||||||| ||| | | |||||| |||||||||||||| |
|
|
| T |
7909342 |
atggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttg |
7909286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 47482911 - 47482871
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
47482911 |
atggtgggaccccttcccggaccctgcgtatgcgggagctt |
47482871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 22)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 4587624 - 4587569
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || ||||||||||||| ||||||| |
|
|
| T |
4587624 |
atggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttg |
4587569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 50606500 - 50606555
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| |||||| ||||||| |
|
|
| T |
50606500 |
atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg |
50606555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 4349735 - 4349790
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
4349735 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
4349790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 34725159 - 34725104
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
34725159 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
34725104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 14617135 - 14617189
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt |
217 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||||| |||||| |||||| |
|
|
| T |
14617135 |
atggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggtt |
14617189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 18742018 - 18741964
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt |
217 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||||||| |||||| |||||| |
|
|
| T |
18742018 |
atggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtt |
18741964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 30555212 - 30555264
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg |
215 |
Q |
| |
|
|||||||||||||||| |||||||||| ||| ||||||||| |||||| |||| |
|
|
| T |
30555212 |
atggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccggg |
30555264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 10668324 - 10668379
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||| |||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
10668324 |
atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttg |
10668379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 19414534 - 19414589
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||| ||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
19414534 |
atggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttg |
19414589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 20004151 - 20004096
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||| ||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
20004151 |
atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg |
20004096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 27201746 - 27201801
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| || |||||| ||||||| |||||| |
|
|
| T |
27201746 |
atggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttg |
27201801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 27474377 - 27474424
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| |
|
|
| T |
27474377 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
27474424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 30395787 - 30395740
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| |||||| |
|
|
| T |
30395787 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgca |
30395740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 35005222 - 35005277
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || | |||| |||||| ||||||| |
|
|
| T |
35005222 |
atggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttg |
35005277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 202
Target Start/End: Complemental strand, 35253248 - 35253209
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
35253248 |
atggtgggaccccttcccggaccctgcatatgcgggagct |
35253209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 45402193 - 45402248
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
45402193 |
atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttg |
45402248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 46248014 - 46247959
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||| | ||||||| |
|
|
| T |
46248014 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttg |
46247959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 46991901 - 46991956
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| | |||||| |||||| ||||||| |
|
|
| T |
46991901 |
atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttg |
46991956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 10378796 - 10378744
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg |
215 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || |||||| |||||| |||| |
|
|
| T |
10378796 |
atggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccggg |
10378744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 202
Target Start/End: Complemental strand, 12126895 - 12126859
Alignment:
| Q |
166 |
gtgggaccccttcccggaccctgcatatacgagagct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||| |
|
|
| T |
12126895 |
gtgggaccccttcccggaccctgcatatgcgggagct |
12126859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 18944742 - 18944782
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
18944742 |
atggtgggaccccttcccggaccctgcgtatgcgggagctt |
18944782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 31382275 - 31382235
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || |||||| |
|
|
| T |
31382275 |
atggtgggaccccttcctggaccctgcatatgcgggagctt |
31382235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 30651 - 30706
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
30651 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
30706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0057 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0057
Description:
Target: scaffold0057; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 46905 - 46960
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
46905 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
46960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 48695 - 48640
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
48695 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
48640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 11)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 1347036 - 1347091
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
1347036 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
1347091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 1354818 - 1354763
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
1354818 |
atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
1354763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 12892083 - 12892138
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||| |||||| || |||||| |||||| ||||||| |
|
|
| T |
12892083 |
atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg |
12892138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 13267799 - 13267854
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||| ||||||||| ||| || ||||||||||||| ||||||| |
|
|
| T |
13267799 |
atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttg |
13267854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 29355916 - 29355861
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
29355916 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg |
29355861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 2166471 - 2166416
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||| || |||||| |||||| ||||||| |
|
|
| T |
2166471 |
atggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttg |
2166416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 2178104 - 2178049
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
||||||||||||||||||||||||| |||| || |||||| |||||| ||||||| |
|
|
| T |
2178104 |
atggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttg |
2178049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 6808469 - 6808524
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||| |||||| ||||||| |
|
|
| T |
6808469 |
atggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttg |
6808524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 218
Target Start/End: Original strand, 26097237 - 26097287
Alignment:
| Q |
168 |
gggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||| |||||| ||||||| |
|
|
| T |
26097237 |
gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg |
26097287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 12221976 - 12221936
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
12221976 |
atggtgggaccccttcccggaccctgcgtatgcgggagctt |
12221936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 32579499 - 32579539
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagctt |
203 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || |||||| |
|
|
| T |
32579499 |
atggtgggaccccttcccagaccctgcatatgcgggagctt |
32579539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 10108 - 10056
Alignment:
| Q |
166 |
gtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| ||||||| ||||||| |
|
|
| T |
10108 |
gtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttg |
10056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 20436 - 20384
Alignment:
| Q |
166 |
gtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||||| ||||||| ||||||| |
|
|
| T |
20436 |
gtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttg |
20384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0311 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0311
Description:
Target: scaffold0311; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 10884 - 10931
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca |
210 |
Q |
| |
|
||||||||||||||||||||||||||| ||| || |||||| |||||| |
|
|
| T |
10884 |
atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca |
10931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0180 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0180
Description:
Target: scaffold0180; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 202
Target Start/End: Complemental strand, 24194 - 24155
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
24194 |
atggtgggaccccttcccggaccctgcatatgcgggagct |
24155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 59053 - 59108
Alignment:
| Q |
163 |
atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg |
218 |
Q |
| |
|
|||||||||||||||||| ||| |||| ||| || |||||| |||||||||||||| |
|
|
| T |
59053 |
atggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttg |
59108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University