View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14363_high_26 (Length: 318)

Name: NF14363_high_26
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14363_high_26
NF14363_high_26
[»] chr3 (26 HSPs)
chr3 (48-158)||(21089003-21089113)
chr3 (240-303)||(21089114-21089177)
chr3 (163-218)||(22122923-22122978)
chr3 (163-215)||(35418000-35418052)
chr3 (163-218)||(353355-353410)
chr3 (163-218)||(13628796-13628851)
chr3 (163-218)||(13730608-13730663)
chr3 (163-218)||(22609861-22609916)
chr3 (163-218)||(24851307-24851362)
chr3 (163-218)||(39203610-39203665)
chr3 (163-218)||(40272818-40272873)
chr3 (163-218)||(54484787-54484842)
chr3 (164-218)||(30452892-30452946)
chr3 (163-208)||(33926179-33926224)
chr3 (163-212)||(46169979-46170028)
chr3 (163-215)||(34771373-34771425)
chr3 (163-203)||(54374366-54374406)
chr3 (163-218)||(1217184-1217239)
chr3 (163-210)||(10795437-10795484)
chr3 (163-218)||(12914041-12914096)
chr3 (163-218)||(15797316-15797371)
chr3 (163-218)||(31592943-31592998)
chr3 (163-218)||(49013479-49013534)
chr3 (179-221)||(4835854-4835896)
chr3 (163-217)||(14987055-14987109)
chr3 (163-203)||(46421056-46421096)
[»] chr2 (15 HSPs)
chr2 (148-218)||(41409921-41409991)
chr2 (163-218)||(13245101-13245156)
chr2 (163-218)||(23488557-23488612)
chr2 (163-218)||(9671253-9671308)
chr2 (163-218)||(10543774-10543829)
chr2 (163-218)||(10546237-10546292)
chr2 (163-218)||(14530394-14530449)
chr2 (163-218)||(21779267-21779322)
chr2 (163-218)||(25079723-25079778)
chr2 (164-218)||(34080176-34080230)
chr2 (164-217)||(34766330-34766383)
chr2 (162-218)||(40579755-40579811)
chr2 (163-210)||(5841104-5841151)
chr2 (163-218)||(8455322-8455377)
chr2 (163-210)||(14444802-14444849)
[»] chr8 (22 HSPs)
chr8 (163-218)||(28817632-28817687)
chr8 (163-218)||(13160775-13160830)
chr8 (163-202)||(19729414-19729453)
chr8 (163-218)||(30454103-30454158)
chr8 (163-218)||(45071338-45071393)
chr8 (163-217)||(7136534-7136588)
chr8 (163-217)||(12670257-12670311)
chr8 (163-221)||(16225095-16225153)
chr8 (164-221)||(27507985-27508042)
chr8 (163-203)||(8897785-8897825)
chr8 (163-219)||(20284074-20284130)
chr8 (163-219)||(21070702-21070758)
chr8 (167-210)||(2626600-2626643)
chr8 (163-218)||(6760898-6760953)
chr8 (163-218)||(12625964-12626019)
chr8 (163-218)||(20869999-20870054)
chr8 (163-218)||(26102591-26102646)
chr8 (163-218)||(35261753-35261808)
chr8 (163-218)||(39461000-39461055)
chr8 (163-218)||(44530223-44530278)
chr8 (163-221)||(16013530-16013588)
chr8 (98-147)||(40196576-40196624)
[»] chr7 (22 HSPs)
chr7 (163-218)||(7879712-7879767)
chr7 (163-218)||(19426896-19426950)
chr7 (163-218)||(21172015-21172070)
chr7 (163-218)||(27629708-27629763)
chr7 (163-218)||(32758333-32758388)
chr7 (163-218)||(42391106-42391161)
chr7 (163-218)||(42798743-42798798)
chr7 (163-218)||(42805600-42805655)
chr7 (163-218)||(48735128-48735183)
chr7 (163-202)||(10693095-10693134)
chr7 (163-218)||(31591115-31591170)
chr7 (163-218)||(34626214-34626269)
chr7 (163-210)||(40463950-40463997)
chr7 (163-218)||(47716535-47716590)
chr7 (163-217)||(2541026-2541080)
chr7 (163-209)||(33500589-33500635)
chr7 (163-217)||(35334823-35334877)
chr7 (163-203)||(18512474-18512514)
chr7 (163-215)||(21566510-21566562)
chr7 (163-203)||(27889337-27889377)
chr7 (163-203)||(28078153-28078193)
chr7 (91-147)||(29117895-29117950)
[»] chr5 (16 HSPs)
chr5 (163-218)||(4619110-4619165)
chr5 (163-218)||(8169990-8170045)
chr5 (163-218)||(13801773-13801828)
chr5 (163-218)||(16957388-16957443)
chr5 (163-218)||(20135680-20135735)
chr5 (163-218)||(32703496-32703551)
chr5 (163-218)||(38879657-38879712)
chr5 (165-218)||(16028630-16028683)
chr5 (163-218)||(24448964-24449019)
chr5 (163-210)||(25622534-25622581)
chr5 (163-218)||(34154820-34154875)
chr5 (163-218)||(41014392-41014447)
chr5 (164-218)||(7368471-7368525)
chr5 (165-218)||(30877570-30877623)
chr5 (163-203)||(10306495-10306535)
chr5 (163-203)||(43574680-43574720)
[»] chr4 (32 HSPs)
chr4 (163-218)||(23501863-23501918)
chr4 (163-218)||(32484307-32484362)
chr4 (163-210)||(5648332-5648379)
chr4 (163-218)||(20225056-20225111)
chr4 (163-218)||(20225150-20225205)
chr4 (163-218)||(20405163-20405218)
chr4 (163-218)||(20639664-20639719)
chr4 (163-218)||(25629123-25629178)
chr4 (163-218)||(29207904-29207959)
chr4 (163-218)||(33836493-33836548)
chr4 (163-218)||(38755914-38755969)
chr4 (163-218)||(38786683-38786738)
chr4 (163-218)||(44363136-44363191)
chr4 (163-210)||(47444031-47444078)
chr4 (161-218)||(40553943-40554000)
chr4 (111-147)||(24362304-24362340)
chr4 (163-203)||(25463196-25463236)
chr4 (163-218)||(11394926-11394981)
chr4 (163-218)||(11404653-11404708)
chr4 (163-218)||(16408607-16408662)
chr4 (163-218)||(21647040-21647095)
chr4 (163-218)||(25388250-25388305)
chr4 (163-210)||(30639453-30639500)
chr4 (163-210)||(40915902-40915949)
chr4 (163-221)||(8820582-8820640)
chr4 (163-193)||(9832344-9832374)
chr4 (163-193)||(30581496-30581526)
chr4 (164-210)||(30690190-30690236)
chr4 (163-208)||(14983908-14983953)
chr4 (163-215)||(54175138-54175191)
chr4 (163-218)||(7909286-7909342)
chr4 (163-203)||(47482871-47482911)
[»] chr1 (22 HSPs)
chr1 (163-218)||(4587569-4587624)
chr1 (163-218)||(50606500-50606555)
chr1 (163-218)||(4349735-4349790)
chr1 (163-218)||(34725104-34725159)
chr1 (163-217)||(14617135-14617189)
chr1 (163-217)||(18741964-18742018)
chr1 (163-215)||(30555212-30555264)
chr1 (163-218)||(10668324-10668379)
chr1 (163-218)||(19414534-19414589)
chr1 (163-218)||(20004096-20004151)
chr1 (163-218)||(27201746-27201801)
chr1 (163-210)||(27474377-27474424)
chr1 (163-210)||(30395740-30395787)
chr1 (163-218)||(35005222-35005277)
chr1 (163-202)||(35253209-35253248)
chr1 (163-218)||(45402193-45402248)
chr1 (163-218)||(46247959-46248014)
chr1 (163-218)||(46991901-46991956)
chr1 (163-215)||(10378744-10378796)
chr1 (166-202)||(12126859-12126895)
chr1 (163-203)||(18944742-18944782)
chr1 (163-203)||(31382235-31382275)
[»] scaffold0168 (1 HSPs)
scaffold0168 (163-218)||(30651-30706)
[»] scaffold0057 (1 HSPs)
scaffold0057 (163-218)||(46905-46960)
[»] scaffold0015 (1 HSPs)
scaffold0015 (163-218)||(48640-48695)
[»] chr6 (11 HSPs)
chr6 (163-218)||(1347036-1347091)
chr6 (163-218)||(1354763-1354818)
chr6 (163-218)||(12892083-12892138)
chr6 (163-218)||(13267799-13267854)
chr6 (163-218)||(29355861-29355916)
chr6 (163-218)||(2166416-2166471)
chr6 (163-218)||(2178049-2178104)
chr6 (163-218)||(6808469-6808524)
chr6 (168-218)||(26097237-26097287)
chr6 (163-203)||(12221936-12221976)
chr6 (163-203)||(32579499-32579539)
[»] scaffold0187 (2 HSPs)
scaffold0187 (166-218)||(10056-10108)
scaffold0187 (166-218)||(20384-20436)
[»] scaffold0311 (1 HSPs)
scaffold0311 (163-210)||(10884-10931)
[»] scaffold0180 (1 HSPs)
scaffold0180 (163-202)||(24155-24194)
[»] scaffold0049 (1 HSPs)
scaffold0049 (163-218)||(59053-59108)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 5e-56; HSPs: 26)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 48 - 158
Target Start/End: Original strand, 21089003 - 21089113
Alignment:
Q  48 gatagataaatttcagaatatttgtaattaatatagtttgacttacgatagattgacaatattaaaaaatatttacattgagagtgtatatgaattaaat 147  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21089003 gatagataaatttcagaatatttgtaattaatatagtttgacttacgatagattgacaatattaaaaaatatttacattgagagtgtatatgaattaaat 21089102  T
Q  148 aaatttcaata 158  Q
    |||||||||||    
T  21089103 aaatttcaata 21089113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 240 - 303
Target Start/End: Original strand, 21089114 - 21089177
Alignment:
Q  240 gatttgcgattgtgagcatgttagtaataatttgtatgagtaaattgaacttgctcagagatgt 303  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21089114 gatttgcgattgcgagcatgttagtaataatttgtatgagtaaattgaacttgctcagagatgt 21089177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 22122978 - 22122923
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| ||||||||  |||||| |||||||    
T  22122978 atggtgggaccccttcccggaccctgcatatgcgagagctctagtgcaccgggttg 22122923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 35418000 - 35418052
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg 215  Q
    |||||||||||||||||||||||| ||| || ||||||||| |||||||||||    
T  35418000 atggtgggaccccttcccggaccccgcaaatgcgagagctttagtgcatcggg 35418052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 353410 - 353355
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| || |||||| |||||| |||||||    
T  353410 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg 353355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 13628851 - 13628796
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  13628851 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 13628796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 13730663 - 13730608
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| || |||||| |||||| |||||||    
T  13730663 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg 13730608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 22609861 - 22609916
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||| ||| ||| || ||||||||||||| |||||||    
T  22609861 atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttg 22609916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 24851362 - 24851307
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||| ||||||||| || |||||| |||||| |||||||    
T  24851362 atggtgggaccccttcccggatcctgcatatgcgggagctttagtgcaccgggttg 24851307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 39203610 - 39203665
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||| ||||||| || |||||| |||||| |||||||    
T  39203610 atggtgggaccccttcccggaccttgcatatgcgggagctttagtgcaccgggttg 39203665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 40272873 - 40272818
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  40272873 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 40272818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 54484787 - 54484842
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  54484787 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 54484842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 218
Target Start/End: Original strand, 30452892 - 30452946
Alignment:
Q  164 tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  30452892 tggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 30452946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 33926179 - 33926224
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtg 208  Q
    ||||||||||||||||| ||||||||||||| ||||||||| ||||    
T  33926179 atggtgggaccccttcctggaccctgcatatgcgagagctttagtg 33926224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 163 - 212
Target Start/End: Complemental strand, 46170028 - 46169979
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatc 212  Q
    ||||| |||||||||||||||||||||||||  | |||||||||||||||    
T  46170028 atggtaggaccccttcccggaccctgcatatgtgggagcttcagtgcatc 46169979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 34771425 - 34771373
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg 215  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| ||||    
T  34771425 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccggg 34771373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 54374406 - 54374366
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||||||| || ||||||    
T  54374406 atggtgggaccccttcccggaccctgcatatgcgggagctt 54374366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 1217184 - 1217239
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||| |||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  1217184 atggcgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 1217239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 10795484 - 10795437
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    ||||||||||||||||| ||||||||| ||| || |||||||||||||    
T  10795484 atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgca 10795437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 12914096 - 12914041
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||| ||||||||||| |||||||||||| || |||||||| |||| |||||||    
T  12914096 atggtgagaccccttcccagaccctgcatatgcgggagcttcaatgcaccgggttg 12914041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 15797316 - 15797371
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||||||||  | |||||  |||||| |||||||    
T  15797316 atggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttg 15797371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 31592943 - 31592998
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||| |||||||||||||||||||| || |||||  |||||| |||||||    
T  31592943 atggtgggactccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 31592998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 49013534 - 49013479
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||  || |||||| |||||| |||||||    
T  49013534 atggtgggaccccttcccggaccccgcatacgcgggagctttagtgcaccgggttg 49013479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 4835854 - 4835896
Alignment:
Q  179 ccggaccctgcatatacgagagcttcagtgcatcgggttgtcc 221  Q
    ||||||||||| |||||| ||||||||||||| ||||||||||    
T  4835854 ccggaccctgcgtatacgtgagcttcagtgcaccgggttgtcc 4835896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 14987055 - 14987109
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt 217  Q
    |||||||||||| |||||||||| ||||||| || |||||| |||||| ||||||    
T  14987055 atggtgggacccattcccggaccttgcatatgcgggagctttagtgcaccgggtt 14987109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 46421096 - 46421056
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||| ||| || ||||||    
T  46421096 atggtgggaccccttcccggaccctgcgtatgcgggagctt 46421056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 15)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 148 - 218
Target Start/End: Original strand, 41409921 - 41409991
Alignment:
Q  148 aaatttcaataatttatggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||| || ||||||||||||||||||||||||||||||||| || ||||||||||||| |||||||    
T  41409921 aaatttcaagaagttatggtgggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttg 41409991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 13245156 - 13245101
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||| |||||||||| |||||| |||| |||||||||    
T  13245156 atggtgggaccccttcccggaccatgcatatacgggagctttagtgtatcgggttg 13245101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 23488557 - 23488612
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| ||||||||| |||||| |||||||    
T  23488557 atggtgggaccccttcccggaccctgcgtatgcgagagctttagtgcaccgggttg 23488612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 9671253 - 9671308
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  9671253 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 9671308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 10543774 - 10543829
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  10543774 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 10543829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 10546237 - 10546292
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  10546237 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 10546292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 14530394 - 14530449
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  14530394 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 14530449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 21779322 - 21779267
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  21779322 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 21779267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 25079778 - 25079723
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| | ||||||| |||||| |||||||    
T  25079778 atggtgggaccccttcccggaccctgcgtatgcaagagctttagtgcaccgggttg 25079723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 218
Target Start/End: Original strand, 34080176 - 34080230
Alignment:
Q  164 tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||||||| || ||| || |||||| |||||||    
T  34080176 tggtgggaccccttcccggaccctgcatatgcgggagttttagtgcaccgggttg 34080230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 217
Target Start/End: Original strand, 34766330 - 34766383
Alignment:
Q  164 tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt 217  Q
    |||||||||||||||||||||||||| ||| || |||||| |||||| ||||||    
T  34766330 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggtt 34766383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 162 - 218
Target Start/End: Complemental strand, 40579811 - 40579755
Alignment:
Q  162 tatggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||||  ||| || |||||| |||||| |||||||    
T  40579811 tatggtgggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttg 40579755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 5841104 - 5841151
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    |||||||||||||||||||||||| |||||| || |||||| ||||||    
T  5841104 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 5841151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 8455377 - 8455322
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| |  |||||| |||||| |||||||    
T  8455377 atggtgggaccccttcccggaccctgcgtatgccggagctttagtgcaccgggttg 8455322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 14444802 - 14444849
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    ||||||||||||||||||||||||||| ||| || |||||| ||||||    
T  14444802 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 14444849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 22)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 28817687 - 28817632
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| ||||||||||||||    
T  28817687 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcatcgggttg 28817632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 13160775 - 13160830
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || ||||||||||||  |||||||    
T  13160775 atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttg 13160830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 202
Target Start/End: Original strand, 19729414 - 19729453
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagct 202  Q
    |||||||||||||||||||||||||||||||||| |||||    
T  19729414 atggtgggaccccttcccggaccctgcatatacgggagct 19729453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 30454158 - 30454103
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  30454158 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 30454103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 45071338 - 45071393
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||| ||| ||| || ||||||||||||| |||||||    
T  45071338 atggtgggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttg 45071393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 7136588 - 7136534
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt 217  Q
    |||||||||||||||||||||||| |||||| || |||||| |||||| ||||||    
T  7136588 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggtt 7136534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 12670311 - 12670257
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt 217  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| ||||||    
T  12670311 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggtt 12670257  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 221
Target Start/End: Original strand, 16225095 - 16225153
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgtcc 221  Q
    ||||||||| |||||||||||||| |||||| || |||||| |||||| ||||||||||    
T  16225095 atggtgggatcccttcccggaccccgcatatgcgggagctttagtgcaccgggttgtcc 16225153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 164 - 221
Target Start/End: Original strand, 27507985 - 27508042
Alignment:
Q  164 tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgtcc 221  Q
    |||||||||||||||||| ||||||| ||| || |||||| |||||| ||||||||||    
T  27507985 tggtgggaccccttcccgaaccctgcgtatgcgggagctttagtgcaccgggttgtcc 27508042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 8897825 - 8897785
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||||||| || ||||||    
T  8897825 atggtgggaccccttcccggaccctgcatatgcgggagctt 8897785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 219
Target Start/End: Complemental strand, 20284130 - 20284074
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgt 219  Q
    ||||||||||||||||||||||||||| ||| || ||| || |||||| ||||||||    
T  20284130 atggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttgt 20284074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 219
Target Start/End: Complemental strand, 21070758 - 21070702
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgt 219  Q
    ||||||||||||||||||||||||||| ||| || ||| || |||||| ||||||||    
T  21070758 atggtgggaccccttcccggaccctgcgtatgcgggagttttagtgcaccgggttgt 21070702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 167 - 210
Target Start/End: Original strand, 2626600 - 2626643
Alignment:
Q  167 tgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    |||||||||||||| |||||||||||| || |||||||||||||    
T  2626600 tgggaccccttcccagaccctgcatatgcgggagcttcagtgca 2626643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 6760898 - 6760953
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||| ||||||| |||||| || |||||| |||||| |||||||    
T  6760898 atggtgggaccccttctcggaccccgcatatgcgggagctttagtgcaccgggttg 6760953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 12625964 - 12626019
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||| ||||||||||||| ||| || |||||| |||||| |||||||    
T  12625964 atggtgggaccccctcccggaccctgcgtatgcgggagctttagtgcaccgggttg 12626019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20869999 - 20870054
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||| |||||| |||||| || |||||| |||||| |||||||    
T  20869999 atggtgggaccccttccaggaccccgcatatgcgggagctttagtgcaccgggttg 20870054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 26102591 - 26102646
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||  |||||| |||||||    
T  26102591 atggtgggaccccttcccggaccctgcttatgcgggagctctagtgcaccgggttg 26102646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 35261753 - 35261808
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||| ||||||||| ||| || |||||| |||||| |||||||    
T  35261753 atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttg 35261808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 39461055 - 39461000
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||| |||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  39461055 atggtgagaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 39461000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 44530223 - 44530278
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||| ||||||||| ||| || |||||| |||||| |||||||    
T  44530223 atggtgggaccccttcctggaccctgcgtatgcgggagctttagtgcaccgggttg 44530278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 221
Target Start/End: Original strand, 16013530 - 16013588
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgtcc 221  Q
    |||||| ||||||||||| |||||||| ||| || |||||| |||||| ||||||||||    
T  16013530 atggtgcgaccccttcccagaccctgcctatgcgggagctttagtgcaccgggttgtcc 16013588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 98 - 147
Target Start/End: Complemental strand, 40196624 - 40196576
Alignment:
Q  98 gattgacaatattaaaaaatatttacattgagagtgtatatgaattaaat 147  Q
    |||||||||||| |||||||||||||||| | | ||||||||||||||||    
T  40196624 gattgacaatat-aaaaaatatttacattaataatgtatatgaattaaat 40196576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 22)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 7879712 - 7879767
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || ||||||||||||| |||||||    
T  7879712 atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttg 7879767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 19426950 - 19426896
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||| ||| |||||||||||||| |||||||||||||||| |||||||    
T  19426950 atggtgggaccc-ttctcggaccctgcatatgcgagagcttcagtgcaccgggttg 19426896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 21172070 - 21172015
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  21172070 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 21172015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 27629708 - 27629763
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||| |||||||||| ||  |||||||||||| |||||||    
T  27629708 atggtgggaccccttcccgggccctgcatatgcggtagcttcagtgcaccgggttg 27629763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 32758333 - 32758388
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  32758333 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 32758388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 42391161 - 42391106
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  42391161 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 42391106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 42798743 - 42798798
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||| |||||||||||||||||| || |||||  ||||||||||||||    
T  42798743 atggtgggaccctttcccggaccctgcatatgcgggagctatagtgcatcgggttg 42798798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 42805600 - 42805655
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| || |||||| |||||| |||||||    
T  42805600 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg 42805655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 48735183 - 48735128
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  48735183 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 48735128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 202
Target Start/End: Complemental strand, 10693134 - 10693095
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagct 202  Q
    ||||||||||||||||||||||||||||||| || |||||    
T  10693134 atggtgggaccccttcccggaccctgcatatgcgggagct 10693095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 31591170 - 31591115
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||| ||||||| || |||||  |||||| |||||||    
T  31591170 atggtgggaccccttcccggaccttgcatatgcgggagctctagtgcaccgggttg 31591115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 34626269 - 34626214
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||| ||||||||||||||||| ||| || |||||| ||| ||||||||||    
T  34626269 atggtgggatcccttcccggaccctgcgtatgcgggagctttagttcatcgggttg 34626214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 40463950 - 40463997
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    |||||||||||||||| |||||||||| ||| || |||||||||||||    
T  40463950 atggtgggaccccttctcggaccctgcgtatgcgggagcttcagtgca 40463997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 47716535 - 47716590
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| || ||||||  ||||| |||||||    
T  47716535 atggtgggaccccttcccggaccccgcatatgcgggagctttggtgcaccgggttg 47716590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 2541080 - 2541026
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt 217  Q
    |||||||||||||||||||| |||||| ||| || |||||| |||||| ||||||    
T  2541080 atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggtt 2541026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 209
Target Start/End: Original strand, 33500589 - 33500635
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgc 209  Q
    ||||||||||||||||||||||||||| ||| || || |||||||||    
T  33500589 atggtgggaccccttcccggaccctgcgtatgcgggatcttcagtgc 33500635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 35334877 - 35334823
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt 217  Q
    ||||||||||||||||||||||||||| ||| |  |||||| |||||| ||||||    
T  35334877 atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggtt 35334823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 18512514 - 18512474
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||| ||| || ||||||    
T  18512514 atggtgggaccccttcccggaccctgcgtatgcgggagctt 18512474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 21566510 - 21566562
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg 215  Q
    ||||| ||||||||||||| ||||||||||| || |||||| |||||| ||||    
T  21566510 atggtaggaccccttcccgaaccctgcatatgcgggagctttagtgcaccggg 21566562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 27889377 - 27889337
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||| ||| || ||||||    
T  27889377 atggtgggaccccttcccggaccctgcgtatgcgggagctt 27889337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 28078193 - 28078153
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||| | ||||||||| |||||||||    
T  28078193 atggtgggaccccttcccgaatcctgcatatgcgagagctt 28078153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 91 - 147
Target Start/End: Complemental strand, 29117950 - 29117895
Alignment:
Q  91 tacgatagattgacaatattaaaaaatatttacattgagagtgtatatgaattaaat 147  Q
    |||||| |||||||||| | |||||||||||||| ||| |||||||||||| |||||    
T  29117950 tacgattgattgacaatct-aaaaaatatttacactgatagtgtatatgaaataaat 29117895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 16)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 4619165 - 4619110
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| ||||||||| |||||| |||||||    
T  4619165 atggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttg 4619110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 8170045 - 8169990
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || ||| ||||||||| |||||||    
T  8170045 atggtgggaccccttcccggaccctgcatatgcgggagtttcagtgcaccgggttg 8169990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 13801828 - 13801773
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| ||||||||| |||||| |||||||    
T  13801828 atggtgggaccccttcccggaccccgcatatgcgagagctttagtgcaccgggttg 13801773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 16957388 - 16957443
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  16957388 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 16957443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20135680 - 20135735
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| |  ||||||||||||| |||||||    
T  20135680 atggtgggaccccttcccggaccccgcatatgcaggagcttcagtgcaccgggttg 20135735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 32703496 - 32703551
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  32703496 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 32703551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 38879657 - 38879712
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  38879657 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 38879712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 165 - 218
Target Start/End: Complemental strand, 16028683 - 16028630
Alignment:
Q  165 ggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  16028683 ggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 16028630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 24448964 - 24449019
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| |  |||||| |||||| |||||||    
T  24448964 atggtgggaccccttcccggaccctgcgtatgcaggagctttagtgcaccgggttg 24449019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 25622534 - 25622581
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    ||||||||||||||||||||||||||| ||| || |||||| ||||||    
T  25622534 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 25622581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 34154875 - 34154820
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| ||  ||||  |||||| |||||||    
T  34154875 atggtgggaccccttcccggaccctgcatatgcggtagctctagtgcaccgggttg 34154820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 41014392 - 41014447
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||| |||||| |||||| || |||||| |||||| |||||||    
T  41014392 atggtgggaccccttcctggaccccgcatatgcgggagctttagtgcaccgggttg 41014447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 218
Target Start/End: Original strand, 7368471 - 7368525
Alignment:
Q  164 tggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||  | |||||  |||||| |||||||    
T  7368471 tggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttg 7368525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 165 - 218
Target Start/End: Complemental strand, 30877623 - 30877570
Alignment:
Q  165 ggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||||||  | |||||  |||||| |||||||    
T  30877623 ggtgggaccccttcccggaccctgcatatgtgggagctctagtgcaccgggttg 30877570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 10306535 - 10306495
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||| ||| || ||||||    
T  10306535 atggtgggaccccttcccggaccctgcgtatgcgggagctt 10306495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 43574680 - 43574720
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||| ||| || ||||||    
T  43574680 atggtgggaccccttcccggaccctgcgtatgcgggagctt 43574720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 32)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 23501863 - 23501918
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||| |||||| |||||||    
T  23501863 atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg 23501918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 32484307 - 32484362
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||| |||||| |||||||    
T  32484307 atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg 32484362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 5648332 - 5648379
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    ||||||||||||||||||||||||||| ||| || |||||||||||||    
T  5648332 atggtgggaccccttcccggaccctgcgtatgcgggagcttcagtgca 5648379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20225056 - 20225111
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  20225056 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 20225111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20225150 - 20225205
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| || |||||| |||||| |||||||    
T  20225150 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg 20225205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 20405163 - 20405218
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| || |||||| ||||||| ||||||    
T  20405163 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcattgggttg 20405218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 20639719 - 20639664
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  20639719 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 20639664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 25629123 - 25629178
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||| ||||| || |||||| |||||| |||||||    
T  25629123 atggtgggaccccttcccggaccctacatatgcgggagctttagtgcaccgggttg 25629178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 29207959 - 29207904
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  29207959 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 29207904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 33836548 - 33836493
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  33836548 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaacgggttg 33836493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 38755969 - 38755914
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  38755969 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 38755914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 38786683 - 38786738
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  38786683 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 38786738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 44363191 - 44363136
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  44363191 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 44363136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 47444031 - 47444078
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    ||||||||||||||||||||||||||||||| |  |||||||||||||    
T  47444031 atggtgggaccccttcccggaccctgcatatgcaggagcttcagtgca 47444078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 161 - 218
Target Start/End: Complemental strand, 40554000 - 40553943
Alignment:
Q  161 ttatggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||| |||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  40554000 ttatggtgtgaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 40553943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 111 - 147
Target Start/End: Complemental strand, 24362340 - 24362304
Alignment:
Q  111 aaaaaatatttacattgagagtgtatatgaattaaat 147  Q
    |||||||||||||||||| ||||||||||||||||||    
T  24362340 aaaaaatatttacattgacagtgtatatgaattaaat 24362304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 25463196 - 25463236
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||||||| || ||||||    
T  25463196 atggtgggaccccttcccggaccctgcatatgcgggagctt 25463236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 11394926 - 11394981
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||| ||||||||||| ||| || |||||| |||||| |||||||    
T  11394926 atggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttg 11394981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 11404653 - 11404708
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||| ||||||||||| ||| || |||||| |||||| |||||||    
T  11404653 atggtgggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttg 11404708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 16408662 - 16408607
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||| |||||||||||||||| |||||| || |||||| |||||| |||||||    
T  16408662 atggtggaaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg 16408607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 21647040 - 21647095
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||| ||||| |||||| || |||||| |||||| |||||||    
T  21647040 atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg 21647095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 25388250 - 25388305
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| |  |||||| |||||| |||||||    
T  25388250 atggtgggaccccttcccggaccctgcgtatgcatgagctttagtgcaccgggttg 25388305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 30639453 - 30639500
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    |||||| |||||||||||||||||||||||| || |||||| ||||||    
T  30639453 atggtgagaccccttcccggaccctgcatatgcgggagctttagtgca 30639500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 40915902 - 40915949
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    ||||||||| ||||||||||||||||| ||| || |||||||||||||    
T  40915902 atggtgggagcccttcccggaccctgcgtatgcgggagcttcagtgca 40915949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 221
Target Start/End: Original strand, 8820582 - 8820640
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttgtcc 221  Q
    |||||||||||||||||| |||||||| ||| |||||| || |||||||| | ||||||    
T  8820582 atggtgggaccccttcccagaccctgcgtatgcgagagttttagtgcatcagattgtcc 8820640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 193
Target Start/End: Complemental strand, 9832374 - 9832344
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatat 193  Q
    |||||||||||||||||||||||||||||||    
T  9832374 atggtgggaccccttcccggaccctgcatat 9832344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 163 - 193
Target Start/End: Complemental strand, 30581526 - 30581496
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatat 193  Q
    |||||||||||||||||||||||||||||||    
T  30581526 atggtgggaccccttcccggaccctgcatat 30581496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 164 - 210
Target Start/End: Complemental strand, 30690236 - 30690190
Alignment:
Q  164 tggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    |||||||||||||||||||||||||| ||| || |||||| ||||||    
T  30690236 tggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 30690190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 208
Target Start/End: Original strand, 14983908 - 14983953
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtg 208  Q
    ||||||||||||||||||||||||||| ||| || |||||| ||||    
T  14983908 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtg 14983953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 54175138 - 54175191
Alignment:
Q  163 atggtgggaccccttccc-ggaccctgcatatacgagagcttcagtgcatcggg 215  Q
    |||||||||||||||||| ||||||||||||| || |||||| |||||| ||||    
T  54175138 atggtgggaccccttccccggaccctgcatatgcgggagctttagtgcaccggg 54175191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 7909342 - 7909286
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatac-gagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||| ||||||| ||| | | |||||| ||||||||||||||    
T  7909342 atggtgggaccccttcccgaaccctgcgtatgcggggagctttagtgcatcgggttg 7909286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 47482911 - 47482871
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||| ||| || ||||||    
T  47482911 atggtgggaccccttcccggaccctgcgtatgcgggagctt 47482871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 22)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 4587624 - 4587569
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || ||||||||||||| |||||||    
T  4587624 atggtgggaccccttcccggaccctgcctatgcgggagcttcagtgcaccgggttg 4587569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 50606500 - 50606555
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||| |||||| |||||||    
T  50606500 atggtgggaccccttcccggaccctgcatatgcgggagctttagtgcaccgggttg 50606555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 4349735 - 4349790
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  4349735 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 4349790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 34725159 - 34725104
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  34725159 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 34725104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Original strand, 14617135 - 14617189
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt 217  Q
    ||||||||| ||||||||||||||||||||| || |||||| |||||| ||||||    
T  14617135 atggtgggatcccttcccggaccctgcatatgcgggagctttagtgcaccgggtt 14617189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 163 - 217
Target Start/End: Complemental strand, 18742018 - 18741964
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggtt 217  Q
    |||||||||||||||||| |||||||| ||| ||||||||| |||||| ||||||    
T  18742018 atggtgggaccccttcccagaccctgcgtatgcgagagctttagtgcaccgggtt 18741964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 163 - 215
Target Start/End: Original strand, 30555212 - 30555264
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg 215  Q
    |||||||||||||||| |||||||||| ||| ||||||||| |||||| ||||    
T  30555212 atggtgggaccccttcacggaccctgcgtatgcgagagctttagtgcaccggg 30555264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 10668324 - 10668379
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||| |||||| ||| || |||||| |||||| |||||||    
T  10668324 atggtgggaccccttcccggtccctgcgtatgcgggagctttagtgcaccgggttg 10668379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 19414534 - 19414589
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||| ||||||||||| || |||||  |||||| |||||||    
T  19414534 atggtgggaccccttcccgtaccctgcatatgcgggagctctagtgcaccgggttg 19414589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 20004151 - 20004096
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||| ||||| |||||| || |||||| |||||| |||||||    
T  20004151 atggtgggaccccttcccagaccccgcatatgcgggagctttagtgcaccgggttg 20004096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 27201746 - 27201801
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||| ||| ||| || |||||| ||||||| ||||||    
T  27201746 atggtgggaccccttcccggaccttgcgtatgcgggagctttagtgcattgggttg 27201801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 27474377 - 27474424
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    ||||||||||||||||||||||||||| ||| || |||||| ||||||    
T  27474377 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 27474424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Complemental strand, 30395787 - 30395740
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    |||||||||||||||||||||||| |||||| || |||||| ||||||    
T  30395787 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgca 30395740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 35005222 - 35005277
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || | |||| |||||| |||||||    
T  35005222 atggtgggaccccttcccggaccctgcgtatgcgggcgctttagtgcaccgggttg 35005277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 202
Target Start/End: Complemental strand, 35253248 - 35253209
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagct 202  Q
    ||||||||||||||||||||||||||||||| || |||||    
T  35253248 atggtgggaccccttcccggaccctgcatatgcgggagct 35253209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 45402193 - 45402248
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||| |||||||| ||| || |||||| |||||| |||||||    
T  45402193 atggtgggaccccttcccagaccctgcgtatgcgggagctttagtgcaccgggttg 45402248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 46248014 - 46247959
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||| | |||||||    
T  46248014 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgtaccgggttg 46247959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 46991901 - 46991956
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| |||  | |||||| |||||| |||||||    
T  46991901 atggtgggaccccttcccggaccctgcgtatgtgggagctttagtgcaccgggttg 46991956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 10378796 - 10378744
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcggg 215  Q
    ||||||||||||||||  ||||||||||||| || |||||| |||||| ||||    
T  10378796 atggtgggaccccttcttggaccctgcatatgcgggagctttagtgcaccggg 10378744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 202
Target Start/End: Complemental strand, 12126895 - 12126859
Alignment:
Q  166 gtgggaccccttcccggaccctgcatatacgagagct 202  Q
    |||||||||||||||||||||||||||| || |||||    
T  12126895 gtgggaccccttcccggaccctgcatatgcgggagct 12126859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 18944742 - 18944782
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||| ||| || ||||||    
T  18944742 atggtgggaccccttcccggaccctgcgtatgcgggagctt 18944782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 31382275 - 31382235
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||| ||||||||||||| || ||||||    
T  31382275 atggtgggaccccttcctggaccctgcatatgcgggagctt 31382235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 30651 - 30706
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  30651 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 30706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 46905 - 46960
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  46905 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 46960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 48695 - 48640
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  48695 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 48640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 11)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 1347036 - 1347091
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  1347036 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 1347091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 1354818 - 1354763
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  1354818 atggtgggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 1354763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 12892083 - 12892138
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||| |||||| || |||||| |||||| |||||||    
T  12892083 atggtgggaccccttcccggaccccgcatatgcgggagctttagtgcaccgggttg 12892138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 13267799 - 13267854
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||| ||||||||| ||| || ||||||||||||| |||||||    
T  13267799 atggtgggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttg 13267854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 29355916 - 29355861
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||| ||| || |||||| |||||| |||||||    
T  29355916 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttg 29355861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 2166471 - 2166416
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||  |||| || |||||| |||||| |||||||    
T  2166471 atggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttg 2166416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Complemental strand, 2178104 - 2178049
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||  |||| || |||||| |||||| |||||||    
T  2178104 atggtgggaccccttcccggaccctatatattcgggagctttagtgcaccgggttg 2178049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 6808469 - 6808524
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    ||||||||||||||||||||||||||  ||| || |||||| |||||| |||||||    
T  6808469 atggtgggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttg 6808524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 168 - 218
Target Start/End: Original strand, 26097237 - 26097287
Alignment:
Q  168 gggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||| || |||||  |||||| |||||||    
T  26097237 gggaccccttcccggaccctgcatatgcgggagctctagtgcaccgggttg 26097287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Complemental strand, 12221976 - 12221936
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    ||||||||||||||||||||||||||| ||| || ||||||    
T  12221976 atggtgggaccccttcccggaccctgcgtatgcgggagctt 12221936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 32579499 - 32579539
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagctt 203  Q
    |||||||||||||||||| |||||||||||| || ||||||    
T  32579499 atggtgggaccccttcccagaccctgcatatgcgggagctt 32579539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0187
Description:

Target: scaffold0187; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 10108 - 10056
Alignment:
Q  166 gtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||||| |  ||||| ||||||| |||||||    
T  10108 gtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttg 10056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0187; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 166 - 218
Target Start/End: Complemental strand, 20436 - 20384
Alignment:
Q  166 gtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||||||||||||| |  ||||| ||||||| |||||||    
T  20436 gtgggaccccttcccggaccctgcatatgcaggagctccagtgcaccgggttg 20384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0311 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0311
Description:

Target: scaffold0311; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 210
Target Start/End: Original strand, 10884 - 10931
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgca 210  Q
    ||||||||||||||||||||||||||| ||| || |||||| ||||||    
T  10884 atggtgggaccccttcccggaccctgcgtatgcgggagctttagtgca 10931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0180 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0180
Description:

Target: scaffold0180; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 202
Target Start/End: Complemental strand, 24194 - 24155
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagct 202  Q
    ||||||||||||||||||||||||||||||| || |||||    
T  24194 atggtgggaccccttcccggaccctgcatatgcgggagct 24155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0049 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 163 - 218
Target Start/End: Original strand, 59053 - 59108
Alignment:
Q  163 atggtgggaccccttcccggaccctgcatatacgagagcttcagtgcatcgggttg 218  Q
    |||||||||||||||||| ||| |||| ||| || |||||| ||||||||||||||    
T  59053 atggtgggaccccttcccagactctgcgtatgcgggagctttagtgcatcgggttg 59108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University