View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14363_high_27 (Length: 317)
Name: NF14363_high_27
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14363_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 103 - 313
Target Start/End: Original strand, 3000251 - 3000460
Alignment:
| Q |
103 |
agtcggacttgcttgaatcgatacgcttaccgctgtctattcaattgattttgttgccccccggcccaggcattgtcttagctcttcacccaacacatat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3000251 |
agtcggacttgcttgaatcgatacgcttaccgctgtctattcaattgattttgttgcccc-cggcccaggcattgtcttagctcttcacccaacacatat |
3000349 |
T |
|
| Q |
203 |
gatagatacggatggggggacgtatgccctactagatgatgcctttactttcactttataaggtaccttcgagacctgaaattactgcctgccctacgag |
302 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3000350 |
gatagatacggatggggggacatatgccctactagatgatgcctttactttcactttataaggtaccttcgagacctgaaattactgcctgccctacgag |
3000449 |
T |
|
| Q |
303 |
aataatttacc |
313 |
Q |
| |
|
||| ||||||| |
|
|
| T |
3000450 |
aatgatttacc |
3000460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University