View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14363_high_40 (Length: 239)
Name: NF14363_high_40
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14363_high_40 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 218
Target Start/End: Original strand, 2254721 - 2254926
Alignment:
| Q |
13 |
gaagcaaaggtgtgtacacacatatagacaaaaatcaaagtttaatattcctcatatggtctaaacattttcaccacctgtgagtaatgagaaccttgtt |
112 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2254721 |
gaagcaaaggtgtgcacacacaaatagacaaaaatcaaagtttaatattcctcatatggtctaaacattttcaccacctgtgagtaatgagaaccttgtt |
2254820 |
T |
 |
| Q |
113 |
caacgggcgttacattatatgtctgctctcaactctgacttcaatgcacaccaacaatcactagctagctagttggaggaagcaattgatctttcttttt |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
2254821 |
caacgggcgttacattatatgtctgctctcaactctgacttcaatgcacaccaacaatcactagctagctagttggaggaagcaattgaactttcttttt |
2254920 |
T |
 |
| Q |
213 |
tcacct |
218 |
Q |
| |
|
| |||| |
|
|
| T |
2254921 |
ttacct |
2254926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University