View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14363_high_41 (Length: 236)
Name: NF14363_high_41
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14363_high_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 31 - 217
Target Start/End: Original strand, 50707398 - 50707584
Alignment:
| Q |
31 |
attattcttctcttctttcagccgttcttgaactgtcacatgttgaagccttgaggtttcaattgtgtactcatcttgcttccctttttcagtgttgatg |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50707398 |
attattcttctcttctttcagccgttcttgaattgtctcatgttgaagccttgaggtttcaattgtgtactcatcttgcttccctttttcagtgttgatg |
50707497 |
T |
|
| Q |
131 |
actgggttttccttatcgaaaaagtgtttaatgacagtgtcatggttagggtatccgcatgcatggagatttttgtttggagaagtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
50707498 |
actgggttttccttatcgaaaaagtgtttaatgacagtgtcatggttagggtatccgcatgcatggagatttttgtttggtgaagtg |
50707584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 38 - 183
Target Start/End: Original strand, 8167335 - 8167483
Alignment:
| Q |
38 |
ttctcttctttcagccgttcttgaactgtcacatgttgaagccttgaggtttcaattgtgtactcat---cttgcttccctttttcagtgttgatgactg |
134 |
Q |
| |
|
|||||||||||||||||||||| || || | ||||||||| |||| ||||||||| | | ||||| | ||||||| ||| |||| || |||||||| |
|
|
| T |
8167335 |
ttctcttctttcagccgttcttcaattgcctcatgttgaaaccttaaggtttcaactacgccctcatgatcctgcttccttttgtcagcgtcgatgactg |
8167434 |
T |
|
| Q |
135 |
ggttttccttatcgaaaaagtgtttaatgacagtgtcatggttagggta |
183 |
Q |
| |
|
|||||||| |||||| ||||||||||||||| |||| | |||||||||| |
|
|
| T |
8167435 |
ggttttccctatcgagaaagtgtttaatgacggtgttagggttagggta |
8167483 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University