View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14363_high_43 (Length: 210)
Name: NF14363_high_43
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14363_high_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 6242775 - 6242819
Alignment:
| Q |
19 |
cttctgacgtgcttcttaagctagctgttttaataggcggagagc |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6242775 |
cttctgacgtgcttcttaagctagctgttttaataggcggagagc |
6242819 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 196
Target Start/End: Original strand, 6242899 - 6242942
Alignment:
| Q |
153 |
tttattattctaattttttaatttgacgcaattttagatgatgt |
196 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6242899 |
tttattattctaattctttaatttgacgcaattttagatgatgt |
6242942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University