View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14363_low_34 (Length: 316)
Name: NF14363_low_34
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14363_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 9 - 301
Target Start/End: Original strand, 53675331 - 53675625
Alignment:
| Q |
9 |
agcacagatataacatatgcttttgcttgcctaagttgtgattgtcttcttctcactgatacacgtttcttcatattctctgctactgaaaattgaacaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53675331 |
agcacagatataacatatgcttttgcttgcctaagttgtgattgtcttcttctcactgatacacgtttcttcatattctctgctactgaaaattgaacaa |
53675430 |
T |
 |
| Q |
109 |
attttcaggctattaaaagaacactaataattcacagtatgaaaaaacggttgaataaattgtacatgttaaaat--nnnnnnnnntagtgactaaccaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
53675431 |
attttcaggctattaaaagaacactaataattcacagtatgaaaaaacggttgaataaattgtacatgttaaaataaaaaaaaaaacagtgactaaccaa |
53675530 |
T |
 |
| Q |
207 |
gaacatgcacagcaacaatggtatcatttggattagctaaaactcttattgcccatgatagaagttccttgctatcatttggatccaaagagagt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
53675531 |
gaacatgcacagcaacaatggtatcatttggattagctaaaactcttattgcccatgatagaagttccttgctatcatttgggtccaaagagagt |
53675625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University