View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14363_low_41 (Length: 270)
Name: NF14363_low_41
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14363_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 15 - 259
Target Start/End: Complemental strand, 35048682 - 35048438
Alignment:
| Q |
15 |
atgtgtatcagccaagaggaatattttattctctaggttcttccccataaatctcactatatttttcttagttctattctactttttgtttactatgact |
114 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35048682 |
atgtgtatcagctaagaggaatattttattctctagattcttccccataaatctcactatatttttcttagttctattctactttttgtttactatgact |
35048583 |
T |
 |
| Q |
115 |
aattggctatatcattttctcctttatgcaataataacgagatcaagtacgactttggtctctgaagcattgtgttatgcacaaataagttatttgtaca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||| | |
|
|
| T |
35048582 |
aattggctatatcattttctcctttatgcaataataacgagatcaagtatgactttggtctctgaagtattgtgttatgcacaaataaattatttgtaga |
35048483 |
T |
 |
| Q |
215 |
cttaaatttacaatcatacacaagaggaagatagttgaatatatt |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35048482 |
cttaaatttacaatcatacacaagaggaagatagttgaatatatt |
35048438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University