View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14363_low_48 (Length: 224)
Name: NF14363_low_48
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14363_low_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 116 - 214
Target Start/End: Original strand, 41809554 - 41809652
Alignment:
| Q |
116 |
tcattgtttctttgcacatgattttgatttgaacttaatcttgatctttaatctcaatataatcaatcatgcatatggtttttatcatcatcatcatca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41809554 |
tcattgtttctttgcacatgattttgatttgaacttaatcttgatccttaatctcaatataatcaatcatgcatatggtttttatcatcatcatcatca |
41809652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 4 - 84
Target Start/End: Original strand, 41809478 - 41809558
Alignment:
| Q |
4 |
tgaataagctctttcgtttcagcttaccgatcaacttaatattctctcaaactgaaatcactcattcacgtaagcttcatt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41809478 |
tgaataagctctttcgtttcagcttaccgatcaacttaatcttctctcaaactgaaatcactcattcacgtaagcttcatt |
41809558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University