View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14363_low_49 (Length: 210)

Name: NF14363_low_49
Description: NF14363
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14363_low_49
NF14363_low_49
[»] chr8 (2 HSPs)
chr8 (19-63)||(6242775-6242819)
chr8 (153-196)||(6242899-6242942)


Alignment Details
Target: chr8 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 6242775 - 6242819
Alignment:
19 cttctgacgtgcttcttaagctagctgttttaataggcggagagc 63  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
6242775 cttctgacgtgcttcttaagctagctgttttaataggcggagagc 6242819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 153 - 196
Target Start/End: Original strand, 6242899 - 6242942
Alignment:
153 tttattattctaattttttaatttgacgcaattttagatgatgt 196  Q
    ||||||||||||||| ||||||||||||||||||||||||||||    
6242899 tttattattctaattctttaatttgacgcaattttagatgatgt 6242942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University