View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14364_high_1 (Length: 353)
Name: NF14364_high_1
Description: NF14364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14364_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 1 - 339
Target Start/End: Original strand, 52369225 - 52369560
Alignment:
| Q |
1 |
agtgcttcaggcagagaaatcactggaacttgtttatgtttcaattgatcacttttggatgaatccatgttttgttctttatcttgaacaaatgaatggt |
100 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52369225 |
agtgcttcaggcagagaaatcaatggaacttgtttatgtttcaattgatcacttttggttgaatccatgttctgttctttatcttgaacaaatgaatggt |
52369324 |
T |
 |
| Q |
101 |
ttctttcaagaatcatgtgttgaggtctgcaatcactcaacctgcttgaagtactcatcttattggacccattatttgacaaatcagtaacagacacccc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
52369325 |
ttctttcaagaatcatatgttgaggtctgcaatcactcaacctgcttgaagtactcatcttattggacccatt---tgacaaatcagtaacagacacccc |
52369421 |
T |
 |
| Q |
201 |
cataaatataatgtcccacaaatctgcacaaaattatatatttataaattagcagccatgccatatagtagttgaatatttattatattggtcaaaacca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369422 |
cataaatataatgtcccacaaatctgcacaaaattatatatttataaattagcagccatgccatatagtagttgaatatttattatattggtcaaaacca |
52369521 |
T |
 |
| Q |
301 |
aataattgcattcatttgttcaacaaattatgatatctg |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52369522 |
aataattgcattcatttgttcaacaaattatgatatctg |
52369560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University