View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14364_high_3 (Length: 246)

Name: NF14364_high_3
Description: NF14364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14364_high_3
NF14364_high_3
[»] chr2 (2 HSPs)
chr2 (67-246)||(6861111-6861292)
chr2 (67-117)||(6854490-6854540)


Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 67 - 246
Target Start/End: Complemental strand, 6861292 - 6861111
Alignment:
67 aaactattttgggagatatgtatggaagtggggtacccttgatttcgtgaaacatggattttagaatacatattcaggtattgtatagttttgtaggaag 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6861292 aaactattttgggagatatgtatggaagtggggtacccttgatttcgtgaaacatggattttagaatacatattcaggtattgtatagttttgtaggaag 6861193  T
167 cattttaaaaaatttgattgagaatttgtaccactcttcctagtag--taataaacatgatagtatattaagtaggttgcaa 246  Q
    ||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||    
6861192 cattttaaaaaatttgattgagaatttgtaccactcttcctagtagtataataaacatgatagtatattaagtaggttgcaa 6861111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 67 - 117
Target Start/End: Complemental strand, 6854540 - 6854490
Alignment:
67 aaactattttgggagatatgtatggaagtggggtacccttgatttcgtgaa 117  Q
    ||||||||||||||||||||||| |||||||||||||||||||||| ||||    
6854540 aaactattttgggagatatgtatagaagtggggtacccttgatttcatgaa 6854490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University