View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14364_low_3 (Length: 246)
Name: NF14364_low_3
Description: NF14364
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14364_low_3 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 67 - 246
Target Start/End: Complemental strand, 6861292 - 6861111
Alignment:
| Q |
67 |
aaactattttgggagatatgtatggaagtggggtacccttgatttcgtgaaacatggattttagaatacatattcaggtattgtatagttttgtaggaag |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6861292 |
aaactattttgggagatatgtatggaagtggggtacccttgatttcgtgaaacatggattttagaatacatattcaggtattgtatagttttgtaggaag |
6861193 |
T |
 |
| Q |
167 |
cattttaaaaaatttgattgagaatttgtaccactcttcctagtag--taataaacatgatagtatattaagtaggttgcaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
6861192 |
cattttaaaaaatttgattgagaatttgtaccactcttcctagtagtataataaacatgatagtatattaagtaggttgcaa |
6861111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 67 - 117
Target Start/End: Complemental strand, 6854540 - 6854490
Alignment:
| Q |
67 |
aaactattttgggagatatgtatggaagtggggtacccttgatttcgtgaa |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
6854540 |
aaactattttgggagatatgtatagaagtggggtacccttgatttcatgaa |
6854490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University