View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14365_low_10 (Length: 373)
Name: NF14365_low_10
Description: NF14365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14365_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 23 - 153
Target Start/End: Original strand, 55161214 - 55161344
Alignment:
| Q |
23 |
tagtaagtaactttcaaattcccaaggatgatgatgcaacctatttcattccatactaccattcatatatttttcttccttcttctacttctagtgatac |
122 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55161214 |
tagtaagtacctttcaaattcccaaggatgatgatgcaacctatttcattccatactaccattcatatatttttcttccttcttctacttctagtgatac |
55161313 |
T |
|
| Q |
123 |
tcatgatgggggtttcttctttctatggttc |
153 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
55161314 |
tgatgatgggggtttcttctttctatggttc |
55161344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 209 - 358
Target Start/End: Original strand, 55161386 - 55161531
Alignment:
| Q |
209 |
ctagtatttgattgattgttttgttgcagatggacccctatatgactttactgcttacactcaggtggtaatattcaattcaattcaattcaattcatgt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55161386 |
ctagtatttgattgattgttttgttgcagatggacccctatatgactttactgcttacactcaggtggtaat-----attcaattcaattcaattcatgt |
55161480 |
T |
|
| Q |
309 |
tgttgttgttttgtaacttataa-ttgtagtattcttctatatgacagaca |
358 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55161481 |
tgttgttgttttgtaacttataacttgtagtattcttctatatgacagaca |
55161531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University