View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14365_low_12 (Length: 296)
Name: NF14365_low_12
Description: NF14365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14365_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 3 - 211
Target Start/End: Original strand, 12884000 - 12884208
Alignment:
| Q |
3 |
aagaaaattcctttgatgaagggtatggggaagttggaaagtaagttgggtgaagtggagtgtggtttatcattagaagcgcaaaggaggctttatgtga |
102 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
12884000 |
aagaaaattcctttgatgaagtgtatggggaagttggaaagtaagttggatgaagtggagtgtggtttatcattagaagagcaaaggaggcttgatgtga |
12884099 |
T |
 |
| Q |
103 |
gggacaatcaggttgtcaatttaagtcttttggcaaagtggagatgaaggttaattcaagaaggtgactcactttaggatgacattttatagaataagta |
202 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| || ||| |
|
|
| T |
12884100 |
gggacattcaggttgtcaatttaagtcttttggcaaagtggagatgaaggttaattcaagaaggtgactcactttagaatgacattttatagagtaggta |
12884199 |
T |
 |
| Q |
203 |
tgggactaa |
211 |
Q |
| |
|
||||||||| |
|
|
| T |
12884200 |
tgggactaa |
12884208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 219 - 282
Target Start/End: Complemental strand, 36656047 - 36655985
Alignment:
| Q |
219 |
aattagcttaagtgttatttatttatattggtgaataaccttgaggttattagttgaagatatt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36656047 |
aattagcttaagtgttatttatttatattggtgaataaccttgagg-tattagttgaagatatt |
36655985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University