View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14365_low_14 (Length: 205)

Name: NF14365_low_14
Description: NF14365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14365_low_14
NF14365_low_14
[»] chr3 (2 HSPs)
chr3 (20-124)||(33007248-33007352)
chr3 (132-187)||(33007553-33007608)


Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 33007248 - 33007352
Alignment:
20 attgtgggaagaaactcataaattgtgaaaacctaggaaaaatggaaaaccaaaaatgggggtgtgggggaacccattaaattctagaagaaaaacggaa 119  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33007248 attgtgagaagaaactcataaattgtgaaaacctaggaaaaatggaaaaccaaaaatgggggtgtgggggaacccattaaattctagaagaaaaacggaa 33007347  T
120 ttggg 124  Q
    |||||    
33007348 ttggg 33007352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 33007553 - 33007608
Alignment:
132 ttagggttcaattacctttgaaaataaacataaaaataagtatctccaaaagtttg 187  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
33007553 ttagggttcaattacctttgaaaatagacataaaaataagtatctccaaaagtttg 33007608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University