View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14365_low_14 (Length: 205)
Name: NF14365_low_14
Description: NF14365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14365_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 20 - 124
Target Start/End: Original strand, 33007248 - 33007352
Alignment:
| Q |
20 |
attgtgggaagaaactcataaattgtgaaaacctaggaaaaatggaaaaccaaaaatgggggtgtgggggaacccattaaattctagaagaaaaacggaa |
119 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33007248 |
attgtgagaagaaactcataaattgtgaaaacctaggaaaaatggaaaaccaaaaatgggggtgtgggggaacccattaaattctagaagaaaaacggaa |
33007347 |
T |
|
| Q |
120 |
ttggg |
124 |
Q |
| |
|
||||| |
|
|
| T |
33007348 |
ttggg |
33007352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 33007553 - 33007608
Alignment:
| Q |
132 |
ttagggttcaattacctttgaaaataaacataaaaataagtatctccaaaagtttg |
187 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33007553 |
ttagggttcaattacctttgaaaatagacataaaaataagtatctccaaaagtttg |
33007608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University