View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14365_low_4 (Length: 477)
Name: NF14365_low_4
Description: NF14365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14365_low_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 414; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 414; E-Value: 0
Query Start/End: Original strand, 23 - 461
Target Start/End: Complemental strand, 16652165 - 16651723
Alignment:
| Q |
23 |
ttctctgctcaatcctttatcctaggctttaacctggtagacac----acaatctttgttattaacttgtagatataatggaaagaacaatgattagaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16652165 |
ttctctgctcaatcctttatcctaggctttaacctggtagacacgtacacaatctttgttattaacttgtagatataatggaaagaacaatgattagaga |
16652066 |
T |
|
| Q |
119 |
cgcatgaagaaagaggaacatgttaattacttgttttgagtaggatttggtctgctaggtggtattcttttaacgcttgcagatacttcttgagatgatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
16652065 |
cgcatgaagaaagaggaacatgttaattacttgttttgagtaggatttggtctgctaggtggtattctttttaggcttgcagatacttcttgagatgatt |
16651966 |
T |
|
| Q |
219 |
ttgatgacccttttttatgtgacagagattggaaagatgaaagcatttttgaaacattggatgaagatgggtaagttctagcttttgcaacatttacctc |
318 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16651965 |
ttgatgacccttttttatgtgaaagagattggaaagatgaaagcatttttgaaacattggatgaagatgggtaagttctagcttttgcaacatttacctc |
16651866 |
T |
|
| Q |
319 |
aagggaaaggatcaatgttagggcaaagatcacaacaatgattaaggtacacaagggtttcatgttggggttttgttgacttggagagggatgtttttca |
418 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16651865 |
aagggaaaggatcaatgttagggcaaagatcacaacaatgattaaggtacacaagggtttcatgttggggttttgttgacttggagagggatgtttttca |
16651766 |
T |
|
| Q |
419 |
cttgcttgatctatgtttgtaatgatgagttatgggcatatat |
461 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16651765 |
cttgcttgatctatgtttgtaatgatgagttatgggcatatat |
16651723 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University