View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14365_low_7 (Length: 419)
Name: NF14365_low_7
Description: NF14365
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14365_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 5e-63; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 69 - 199
Target Start/End: Original strand, 55161214 - 55161344
Alignment:
| Q |
69 |
tagtaagtaactttcaaattcccaaggatgatgatgcaacctatttcattccatactaccattcatatatttttcttccttcttctacttctagtgatac |
168 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55161214 |
tagtaagtacctttcaaattcccaaggatgatgatgcaacctatttcattccatactaccattcatatatttttcttccttcttctacttctagtgatac |
55161313 |
T |
|
| Q |
169 |
tcatgatgggggtttcttctttctatggttc |
199 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
55161314 |
tgatgatgggggtttcttctttctatggttc |
55161344 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 255 - 404
Target Start/End: Original strand, 55161386 - 55161531
Alignment:
| Q |
255 |
ctagtatttgattgattgttttgttgcagatggacccctatatgactttactgcttacactcaggtggtaatattcaattcaattcaattcaattcatgt |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55161386 |
ctagtatttgattgattgttttgttgcagatggacccctatatgactttactgcttacactcaggtggtaat-----attcaattcaattcaattcatgt |
55161480 |
T |
|
| Q |
355 |
tgttgttgttttgtaacttataa-ttgtagtattcttctatatgacagaca |
404 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55161481 |
tgttgttgttttgtaacttataacttgtagtattcttctatatgacagaca |
55161531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 33 - 73
Target Start/End: Original strand, 55161164 - 55161204
Alignment:
| Q |
33 |
atttttgtttcatatgatacttaacacaggcagtagtagta |
73 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55161164 |
atttttgtttcatatgctacttaacacaggcagtagtagta |
55161204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University