View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14366_high_47 (Length: 268)

Name: NF14366_high_47
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14366_high_47
NF14366_high_47
[»] chr4 (2 HSPs)
chr4 (135-215)||(20649874-20649955)
chr4 (8-69)||(32344703-32344764)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 135 - 215
Target Start/End: Original strand, 20649874 - 20649955
Alignment:
135 tttcagagattgggtggttttggatgtg-cctcttgtggttcggtttgcgattcatcaatctgaaagggtctgtttgtgttt 215  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||    
20649874 tttcagagattgggtggttttggatgtggcctcttgtggttcggtttgcgattcatcaacctgaaagggtctgtttgtgttt 20649955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 32344764 - 32344703
Alignment:
8 cgaagaaaatggtagagtttgggtaatctttatgattattattatgtgataaaagttatcca 69  Q
    |||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||    
32344764 cgaagaaagtgatagagtttgggtaatctttatgattattattatgtgataaaagttatcca 32344703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University