View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_high_47 (Length: 268)
Name: NF14366_high_47
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 135 - 215
Target Start/End: Original strand, 20649874 - 20649955
Alignment:
| Q |
135 |
tttcagagattgggtggttttggatgtg-cctcttgtggttcggtttgcgattcatcaatctgaaagggtctgtttgtgttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20649874 |
tttcagagattgggtggttttggatgtggcctcttgtggttcggtttgcgattcatcaacctgaaagggtctgtttgtgttt |
20649955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 8 - 69
Target Start/End: Complemental strand, 32344764 - 32344703
Alignment:
| Q |
8 |
cgaagaaaatggtagagtttgggtaatctttatgattattattatgtgataaaagttatcca |
69 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32344764 |
cgaagaaagtgatagagtttgggtaatctttatgattattattatgtgataaaagttatcca |
32344703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University