View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_high_57 (Length: 239)
Name: NF14366_high_57
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_high_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 86 - 144
Target Start/End: Complemental strand, 13382506 - 13382448
Alignment:
| Q |
86 |
ggataagagatagtccgactatatgtttataaacgaggacaatcctcacctcagaaact |
144 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
13382506 |
ggataagagatagtctgacaatatgtttataaacgaggacaatcctcatctcataaact |
13382448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 221
Target Start/End: Complemental strand, 13382429 - 13382397
Alignment:
| Q |
189 |
tggaactgccataaacttttattgtgtttgtag |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
13382429 |
tggaactaccataaacttttattgtgtttgtag |
13382397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University