View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_high_59 (Length: 237)
Name: NF14366_high_59
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_high_59 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 17223223 - 17223461
Alignment:
| Q |
1 |
aagaagcaatcaaaatcaaataaaaaactcatatagtccattagtcttgagtctaagagagaga--gaaataatagaaaagaggnnnnnnntgtaaagtt |
98 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
17223223 |
aagaagcaatcaaaatcaaatcaaaaactcatatagtccattagtcttgagtccaagagagagaaagaaagaatagaaaagaggacaaaaatgtaaagtt |
17223322 |
T |
 |
| Q |
99 |
agagacaaacccacaccattttttcattcatttgtagatcaccataaaccctccaactttgcaacacctcaagaactacgtagctttgaattttctatca |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17223323 |
agagacaaacccacatcattttttcattcatttgtagatcaccataaaccctccaactttgcaacaccccaagaactacgtagctttgaattttctatca |
17223422 |
T |
 |
| Q |
199 |
cattgagagatatgtaagaacaaaatatcactcacgttg |
237 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
17223423 |
cattgagagatatgtaagaacaagataccactcatgttg |
17223461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University