View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_high_61 (Length: 232)
Name: NF14366_high_61
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_high_61 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 66 - 214
Target Start/End: Original strand, 33626936 - 33627083
Alignment:
| Q |
66 |
aatagaaaatcacccaccttaacaagatccttttttgggggtagatccatcaagtcttctaacttataatggtaatgcataagagaaatgaagactttaa |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||| |
|
|
| T |
33626936 |
aatagaaaatcacccaccttaacaagatccttttttgggggtagatccatcaagtcttctaacttata-tggtaatgcataagagaaatgaagactctaa |
33627034 |
T |
 |
| Q |
166 |
caactcctctttctaacttaacgtgtgtatatttttccgaaggaactta |
214 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33627035 |
caactcttctttctaacttaacgtgtgtatatttttccgaaggaactta |
33627083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University