View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_high_64 (Length: 226)
Name: NF14366_high_64
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_high_64 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 71 - 219
Target Start/End: Original strand, 19846929 - 19847077
Alignment:
| Q |
71 |
ggatgagggaaaagatgggtgtttgttctgtgaattctgggaatccaacgagttcgtcatcaagggaccttcaactccctagtggttatcagagtattga |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19846929 |
ggatgagggaaaagatgggtgtttgttctgtgaattttgggaatctaacgagttcgtcatcaagggaccttcaactccctaatggttatcagagtattga |
19847028 |
T |
|
| Q |
171 |
ttatggcggatgttgttgtcgttttggagttagtcctggctttcctatg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19847029 |
ttatggcggatgttgttgtcgttttggagttagtcctggatttcctatg |
19847077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University