View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_low_36 (Length: 354)
Name: NF14366_low_36
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 287; Significance: 1e-161; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 30 - 339
Target Start/End: Original strand, 10563714 - 10564021
Alignment:
| Q |
30 |
gaagttgaaacaatgctattttgttgagatggagggccaaatctccatgtggttgatggagtactacaaactcctccccttttccctaccaaaacacctt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10563714 |
gaagttgaaacaatgctattttgttgagatggagggtcaaatctccatgtggttgatggagtactacaaattcctccccttttccctaccaaaacacctt |
10563813 |
T |
 |
| Q |
130 |
tcttccacttttcaaccattactattctctttttgtcccctctctcacacacaaaactcattgtttatgtttgaaaataaatttactttgttttaacaac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10563814 |
tcttccacttttcaaccattactattctctttttgtcccctctctcacacacaaaactcattgtttatgtttgaaaataaatttactttgttttaacaac |
10563913 |
T |
 |
| Q |
230 |
aacagactttacaatgtttcttgttttctatgttctgcaggttccatcaacaagttatgtgttaccaaacttatttatagccacatcagcagttccttct |
329 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10563914 |
aacagactttacaatgtttcttgttttctatgttctgcaggttccatcaacaagtta--tgttaccaaacttatttatagccacatcagcagttacttct |
10564011 |
T |
 |
| Q |
330 |
tcgtatatag |
339 |
Q |
| |
|
|||||||||| |
|
|
| T |
10564012 |
tcgtatatag |
10564021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University