View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_low_48 (Length: 304)
Name: NF14366_low_48
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 1 - 289
Target Start/End: Original strand, 17223598 - 17223905
Alignment:
| Q |
1 |
ttgagatatctacaaaaatttgaataaattttggtggcgactttattgttttcgaccaaccctcaaattctaggtcatgttttcttcataaagatatgta |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17223598 |
ttgagatatctacacaaatttgaataaattttggtggcgactttattgttttcgaccaaccctcaaattctaggtcatgttttcttcataaagatatgta |
17223697 |
T |
 |
| Q |
101 |
catgaaggtgcctcaaggcctgaccctcagaaacctaaccaagtttgccagttgcaaaagtccctatatgctttgaattgcaagcaagtcactaatggta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
17223698 |
catgaaggtgcctcaaggcctgaccctcagaaatctagccaagtttgccagttacaaaagtccctatatgctttg-attgcaagcaagtcactaatggta |
17223796 |
T |
 |
| Q |
201 |
tgaaaatcttacga--------------------tacaaacaagcatcatcatatcatactttgtttcctttatcctatgagatatcttcacaaccttat |
280 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17223797 |
tgaaaatcttgcgatttttctcatacatctaggctacaaacaagcatcatcatatcatactttgtttcctttatcctatgagatatcttcacaaccttat |
17223896 |
T |
 |
| Q |
281 |
ggttggaaa |
289 |
Q |
| |
|
||||||||| |
|
|
| T |
17223897 |
ggttggaaa |
17223905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 38319025 - 38318980
Alignment:
| Q |
18 |
atttgaataaattttggtggcgactttattgttttcgaccaaccct |
63 |
Q |
| |
|
|||| |||||||||||||||| ||||| |||||||||| ||||||| |
|
|
| T |
38319025 |
attttaataaattttggtggcaactttgttgttttcgagcaaccct |
38318980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University