View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_low_56 (Length: 252)
Name: NF14366_low_56
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_low_56 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 7e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 75 - 234
Target Start/End: Complemental strand, 36358204 - 36358045
Alignment:
| Q |
75 |
ttagctacacctgcaaatcttgtgcttggattccaaatattttggatcagaacaaacttttgacannnnnnnnnnnngatatggatcataagactaagtt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36358204 |
ttagctacacctgcaaatcttgtgcttggattccaaatattttggatcagaacaaacttttgacattttttctttttgatatggatcataagactaagtt |
36358105 |
T |
|
| Q |
175 |
atggatggtgtttttcttcttctcaagtgcaacatattgtgttgttgggaagccccaagt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36358104 |
atggatggtgtttttcttcttctcaagtgcaacatattgtgttgttgggaagccccaagt |
36358045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 56
Target Start/End: Complemental strand, 36358250 - 36358219
Alignment:
| Q |
25 |
caaggtcatacaaatttttgtctttcatctct |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36358250 |
caaggtcatacaaatttttgtctttcatctct |
36358219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University