View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_low_57 (Length: 251)
Name: NF14366_low_57
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_low_57 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 228; Significance: 1e-126; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 13882044 - 13881787
Alignment:
| Q |
1 |
tgaagttgaaggagatggaacgtcattgccattttctaaacgtgaagccattggcaaagcatgtaccccatttatgttcttactagacattcactccctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13882044 |
tgaagttgaaggagatggaacgtcattgccattttctaaacgtgaagccattggcaaagcatgtaccccatttatgttcttactagacattcactccctt |
13881945 |
T |
|
| Q |
101 |
ctgactttcaaaaccttaattggttttctctgtagtt-------tcaagttgtataattagtgtataattagcacagttacctttcattcagtatgattg |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13881944 |
ctgactttcaaaaccttaattggttttctctgtagtttcaactttcaagttgtataattattgtataattagcacagttacctttcattcagtatgattg |
13881845 |
T |
|
| Q |
194 |
tactctactaaaattataatgtctaaattatacccttatataaacttgggaaagatga |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13881844 |
tactctactaaaattataatgtctaaattatacccttatataaacttgggaaagatga |
13881787 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 5 - 37
Target Start/End: Original strand, 14393189 - 14393221
Alignment:
| Q |
5 |
gttgaaggagatggaacgtcattgccattttct |
37 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
14393189 |
gttgaaggagatggaatgtcattgccattttct |
14393221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University