View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14366_low_64 (Length: 239)

Name: NF14366_low_64
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14366_low_64
NF14366_low_64
[»] chr1 (2 HSPs)
chr1 (86-144)||(13382448-13382506)
chr1 (189-221)||(13382397-13382429)


Alignment Details
Target: chr1 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 86 - 144
Target Start/End: Complemental strand, 13382506 - 13382448
Alignment:
86 ggataagagatagtccgactatatgtttataaacgaggacaatcctcacctcagaaact 144  Q
    ||||||||||||||| ||| |||||||||||||||||||||||||||| |||| |||||    
13382506 ggataagagatagtctgacaatatgtttataaacgaggacaatcctcatctcataaact 13382448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 189 - 221
Target Start/End: Complemental strand, 13382429 - 13382397
Alignment:
189 tggaactgccataaacttttattgtgtttgtag 221  Q
    ||||||| |||||||||||||||||||||||||    
13382429 tggaactaccataaacttttattgtgtttgtag 13382397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University