View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14366_low_76 (Length: 211)
Name: NF14366_low_76
Description: NF14366
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14366_low_76 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 17 - 196
Target Start/End: Complemental strand, 39166116 - 39165937
Alignment:
| Q |
17 |
atgtcaacaacaatggttctacttctagtgtttgtttggatgtagatgctaacaacatagttgtcaccaatagttgcaaatgtattagcaaagttaacac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166116 |
atgtcaacaacaatggttctacttctagtgtttgtttggatgtagatgctaacaacatagttgtcaccaatagttgcaaatgtattagcaaagttaacac |
39166017 |
T |
 |
| Q |
117 |
atgtgaccctgcaagccaatggttcaaacttgttgacagtacaagaaagttgaactgaagattatctatagatttgatgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166016 |
atgtgaccctgcaagccaatggttcaaacttgttgacagtacaagaaagttgaactgaagattatctatagatttgatgt |
39165937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University