View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14368_high_5 (Length: 480)
Name: NF14368_high_5
Description: NF14368
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14368_high_5 |
 | |
|
| [»] scaffold0001 (3 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 101; Significance: 7e-50; HSPs: 3)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 101; E-Value: 7e-50
Query Start/End: Original strand, 222 - 322
Target Start/End: Complemental strand, 415522 - 415422
Alignment:
| Q |
222 |
catgcatacagggagagaaagagaatcacagagttttgcaatctgctgctgttgatcacttgtttgaatgttggttcctgtctccgagtctgagattcga |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
415522 |
catgcatacagggagagaaagagaatcacagagttttgcaatctgctgctgttgatcacttgtttgaatgttggttcctgtctccgagtctgagattcga |
415423 |
T |
|
| Q |
322 |
t |
322 |
Q |
| |
|
| |
|
|
| T |
415422 |
t |
415422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 396 - 463
Target Start/End: Complemental strand, 415348 - 415281
Alignment:
| Q |
396 |
gttaccatgatttttctttagcagaagaactctaggagttcttttttgtttagtgaaagtcatccatg |
463 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
415348 |
gttaccatgatttttctttagcagaagaactctaggagttcttttttgtttagtgaaagtcatccatg |
415281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 10 - 144
Target Start/End: Complemental strand, 415748 - 415603
Alignment:
| Q |
10 |
aagaatatcaaatgaaacaatcataaattgtttgttcaaatttgaaagaat-----aagaaag------aaagaagaagccatataaatctcctaccata |
98 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||| || | | ||||||||||||| ||||||||||||||| |
|
|
| T |
415748 |
aagaaaatcaaatgaaactatcataaattgtttgttcaaatttgaaagaatggatctagtagggtatgtgtagaagaagccatacaaatctcctaccata |
415649 |
T |
|
| Q |
99 |
acaccaaaactcatattgttgtaaataaagtgcaatcaatgctatg |
144 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
415648 |
actccaaaactcatattgttgtaaataaagtgcaatcaatgctatg |
415603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University